FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637209_at:

>probe:Drosophila_2:1637209_at:594:477; Interrogation_Position=1064; Antisense; GTATTCCCGGAAACCTGGGCAGGAT
>probe:Drosophila_2:1637209_at:257:55; Interrogation_Position=1123; Antisense; ATGAATTGCCAGAAGCCCTACTGCC
>probe:Drosophila_2:1637209_at:414:283; Interrogation_Position=1143; Antisense; CTGCCCAAAGATCTACAAGCCTGTG
>probe:Drosophila_2:1637209_at:666:417; Interrogation_Position=1193; Antisense; GAGCGTGTCCCATGCGTGACATAGT
>probe:Drosophila_2:1637209_at:271:21; Interrogation_Position=1213; Antisense; ATAGTCTCCAGAACGAATCGGCGGG
>probe:Drosophila_2:1637209_at:379:11; Interrogation_Position=663; Antisense; ATTCTATAAACCATCCCGACCGAAT
>probe:Drosophila_2:1637209_at:581:631; Interrogation_Position=747; Antisense; TCCGTCGCTTCCATTAAAGGCAGTC
>probe:Drosophila_2:1637209_at:38:293; Interrogation_Position=830; Antisense; CGTCAGATCTCTCGGAAGGCCTGGA
>probe:Drosophila_2:1637209_at:512:369; Interrogation_Position=844; Antisense; GAAGGCCTGGAGTACCCCGATGGCT
>probe:Drosophila_2:1637209_at:285:149; Interrogation_Position=872; Antisense; ACTTTCCCTGGTGCTATATGCCGCA
>probe:Drosophila_2:1637209_at:564:241; Interrogation_Position=906; Antisense; AATTTGTCAACCACCCTACTGTTAT
>probe:Drosophila_2:1637209_at:279:669; Interrogation_Position=922; Antisense; TACTGTTATCCGTGCAGATCGCCAC
>probe:Drosophila_2:1637209_at:722:311; Interrogation_Position=942; Antisense; GCCACACTGCGATTCCAAATGCGTT
>probe:Drosophila_2:1637209_at:119:465; Interrogation_Position=973; Antisense; GATTGCTATCCACCCTGCAAAGAAC

Paste this into a BLAST search page for me
GTATTCCCGGAAACCTGGGCAGGATATGAATTGCCAGAAGCCCTACTGCCCTGCCCAAAGATCTACAAGCCTGTGGAGCGTGTCCCATGCGTGACATAGTATAGTCTCCAGAACGAATCGGCGGGATTCTATAAACCATCCCGACCGAATTCCGTCGCTTCCATTAAAGGCAGTCCGTCAGATCTCTCGGAAGGCCTGGAGAAGGCCTGGAGTACCCCGATGGCTACTTTCCCTGGTGCTATATGCCGCAAATTTGTCAACCACCCTACTGTTATTACTGTTATCCGTGCAGATCGCCACGCCACACTGCGATTCCAAATGCGTTGATTGCTATCCACCCTGCAAAGAAC

Full Affymetrix probeset data:

Annotations for 1637209_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720