FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637211_at:

>probe:Drosophila_2:1637211_at:226:83; Interrogation_Position=135; Antisense; AGTGGCGGTACCTGCTCCAGTAGCA
>probe:Drosophila_2:1637211_at:459:307; Interrogation_Position=151; Antisense; CCAGTAGCAGTACCCGTTTCCGATA
>probe:Drosophila_2:1637211_at:256:603; Interrogation_Position=16; Antisense; TGTTTTGGTGCTCCAGCGCTTGGAA
>probe:Drosophila_2:1637211_at:317:119; Interrogation_Position=189; Antisense; AGCGGCCTTTAGTGCCCATCAAGGA
>probe:Drosophila_2:1637211_at:144:671; Interrogation_Position=220; Antisense; TACGGAGCTGTCGATCACTATGGTC
>probe:Drosophila_2:1637211_at:489:307; Interrogation_Position=247; Antisense; CCACCTCCGGCGATCTTTAAATATG
>probe:Drosophila_2:1637211_at:118:25; Interrogation_Position=267; Antisense; ATATGCTACAACCTATGCGGCACCA
>probe:Drosophila_2:1637211_at:661:567; Interrogation_Position=285; Antisense; GGCACCACAGCCAGTTATTAAGTAC
>probe:Drosophila_2:1637211_at:622:13; Interrogation_Position=301; Antisense; ATTAAGTACTCCCTTGGAGCTCCAG
>probe:Drosophila_2:1637211_at:93:129; Interrogation_Position=372; Antisense; ACCAGCCGTTCATTATGCTGCAGCA
>probe:Drosophila_2:1637211_at:659:479; Interrogation_Position=41; Antisense; GTTTCCATCATGAACCATCGACGGT
>probe:Drosophila_2:1637211_at:700:141; Interrogation_Position=442; Antisense; ACTGGCTATCAGTTTGCAGCTGCTG
>probe:Drosophila_2:1637211_at:431:71; Interrogation_Position=481; Antisense; AGGTACAAGCTCCACTTTGGGTCAC
>probe:Drosophila_2:1637211_at:322:487; Interrogation_Position=550; Antisense; GTAGCATTTAGCACTCAGGGCTGGT

Paste this into a BLAST search page for me
AGTGGCGGTACCTGCTCCAGTAGCACCAGTAGCAGTACCCGTTTCCGATATGTTTTGGTGCTCCAGCGCTTGGAAAGCGGCCTTTAGTGCCCATCAAGGATACGGAGCTGTCGATCACTATGGTCCCACCTCCGGCGATCTTTAAATATGATATGCTACAACCTATGCGGCACCAGGCACCACAGCCAGTTATTAAGTACATTAAGTACTCCCTTGGAGCTCCAGACCAGCCGTTCATTATGCTGCAGCAGTTTCCATCATGAACCATCGACGGTACTGGCTATCAGTTTGCAGCTGCTGAGGTACAAGCTCCACTTTGGGTCACGTAGCATTTAGCACTCAGGGCTGGT

Full Affymetrix probeset data:

Annotations for 1637211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720