FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637212_at:

>probe:Drosophila_2:1637212_at:220:121; Interrogation_Position=345; Antisense; AGCGGCGGCACTGATGGCATCCGAT
>probe:Drosophila_2:1637212_at:4:69; Interrogation_Position=358; Antisense; ATGGCATCCGATTGCGGTGAACTGC
>probe:Drosophila_2:1637212_at:428:321; Interrogation_Position=429; Antisense; GCGCGTTTCGCTCAACGAGTTGCAA
>probe:Drosophila_2:1637212_at:286:167; Interrogation_Position=452; Antisense; AAATGCCGATGCATCATGACCGCGG
>probe:Drosophila_2:1637212_at:460:453; Interrogation_Position=530; Antisense; GATCACCAAAGTGCGCGTTGCGACG
>probe:Drosophila_2:1637212_at:119:327; Interrogation_Position=549; Antisense; GCGACGCAGCGATTTGATTACCAAA
>probe:Drosophila_2:1637212_at:99:475; Interrogation_Position=593; Antisense; GTTACATGCTTAGGCGTCTGACCAA
>probe:Drosophila_2:1637212_at:67:611; Interrogation_Position=611; Antisense; TGACCAATCGCCAGGATAGCATGAA
>probe:Drosophila_2:1637212_at:204:1; Interrogation_Position=631; Antisense; ATGAACTCCACCTCGTCGGGTAACA
>probe:Drosophila_2:1637212_at:233:609; Interrogation_Position=722; Antisense; TGACCAGCCACTCGGAGGCCAAAAT
>probe:Drosophila_2:1637212_at:288:289; Interrogation_Position=794; Antisense; CGGCATTGCCACTCTATTGTCTGGG
>probe:Drosophila_2:1637212_at:439:3; Interrogation_Position=809; Antisense; ATTGTCTGGGCAACTCGTTTCCGCA
>probe:Drosophila_2:1637212_at:714:479; Interrogation_Position=825; Antisense; GTTTCCGCACATCGACAGCGATGAG
>probe:Drosophila_2:1637212_at:627:657; Interrogation_Position=894; Antisense; TAAGCAACGGCACAACGCAGCGTAT

Paste this into a BLAST search page for me
AGCGGCGGCACTGATGGCATCCGATATGGCATCCGATTGCGGTGAACTGCGCGCGTTTCGCTCAACGAGTTGCAAAAATGCCGATGCATCATGACCGCGGGATCACCAAAGTGCGCGTTGCGACGGCGACGCAGCGATTTGATTACCAAAGTTACATGCTTAGGCGTCTGACCAATGACCAATCGCCAGGATAGCATGAAATGAACTCCACCTCGTCGGGTAACATGACCAGCCACTCGGAGGCCAAAATCGGCATTGCCACTCTATTGTCTGGGATTGTCTGGGCAACTCGTTTCCGCAGTTTCCGCACATCGACAGCGATGAGTAAGCAACGGCACAACGCAGCGTAT

Full Affymetrix probeset data:

Annotations for 1637212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720