FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637213_at:

>probe:Drosophila_2:1637213_at:661:609; Interrogation_Position=351; Antisense; TGACCAACACGTTCAGTTCGCTGAG
>probe:Drosophila_2:1637213_at:193:461; Interrogation_Position=422; Antisense; GATTATACATCCAGACGTGCTCAGA
>probe:Drosophila_2:1637213_at:456:505; Interrogation_Position=438; Antisense; GTGCTCAGACCTTTTACGACGGTGC
>probe:Drosophila_2:1637213_at:712:135; Interrogation_Position=453; Antisense; ACGACGGTGCCGTGGGTAGTCCATT
>probe:Drosophila_2:1637213_at:313:87; Interrogation_Position=470; Antisense; AGTCCATTGGGCGTCTGTCACGTGC
>probe:Drosophila_2:1637213_at:558:53; Interrogation_Position=497; Antisense; ATGAATCCGACCTTTTGCGAACGCA
>probe:Drosophila_2:1637213_at:636:373; Interrogation_Position=548; Antisense; GAAGAGCTGGGATTCCCCACGGGAT
>probe:Drosophila_2:1637213_at:702:619; Interrogation_Position=585; Antisense; TGCTCACACTGGAAGGACCGCGTTA
>probe:Drosophila_2:1637213_at:120:661; Interrogation_Position=607; Antisense; TTACTCCACCGTTGCCGAAAACAAT
>probe:Drosophila_2:1637213_at:136:453; Interrogation_Position=653; Antisense; GATCTGCTGAGCATGACCCTGTGTC
>probe:Drosophila_2:1637213_at:80:287; Interrogation_Position=722; Antisense; CTGGGTCTGGTCACCAACATGGAGT
>probe:Drosophila_2:1637213_at:670:189; Interrogation_Position=737; Antisense; AACATGGAGTGCTGGTGCGCCAAGC
>probe:Drosophila_2:1637213_at:125:377; Interrogation_Position=802; Antisense; GAAGCAATCCGAAAACCTCCAGAAG
>probe:Drosophila_2:1637213_at:505:371; Interrogation_Position=823; Antisense; GAAGGTCCTGATAACGGCTATTCGG

Paste this into a BLAST search page for me
TGACCAACACGTTCAGTTCGCTGAGGATTATACATCCAGACGTGCTCAGAGTGCTCAGACCTTTTACGACGGTGCACGACGGTGCCGTGGGTAGTCCATTAGTCCATTGGGCGTCTGTCACGTGCATGAATCCGACCTTTTGCGAACGCAGAAGAGCTGGGATTCCCCACGGGATTGCTCACACTGGAAGGACCGCGTTATTACTCCACCGTTGCCGAAAACAATGATCTGCTGAGCATGACCCTGTGTCCTGGGTCTGGTCACCAACATGGAGTAACATGGAGTGCTGGTGCGCCAAGCGAAGCAATCCGAAAACCTCCAGAAGGAAGGTCCTGATAACGGCTATTCGG

Full Affymetrix probeset data:

Annotations for 1637213_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720