Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637215_at:

>probe:Drosophila_2:1637215_at:649:37; Interrogation_Position=351; Antisense; ATCTTTATGCAATTCATCGGCTCCA
>probe:Drosophila_2:1637215_at:378:211; Interrogation_Position=417; Antisense; AAGAACATCGCCAAGTGCCGCATTT
>probe:Drosophila_2:1637215_at:184:87; Interrogation_Position=430; Antisense; AGTGCCGCATTTGCAATGGCGAACA
>probe:Drosophila_2:1637215_at:526:431; Interrogation_Position=458; Antisense; GAGTGTCAATTGTCCCTACAAGGGC
>probe:Drosophila_2:1637215_at:217:161; Interrogation_Position=475; Antisense; ACAAGGGCACCTCGATGGATAGCAA
>probe:Drosophila_2:1637215_at:644:351; Interrogation_Position=531; Antisense; GCAGCTGCCGCTATAAGTGATCCCA
>probe:Drosophila_2:1637215_at:670:161; Interrogation_Position=567; Antisense; AAATATGTACCACCCTTCATGAAGG
>probe:Drosophila_2:1637215_at:166:11; Interrogation_Position=646; Antisense; ATTCGTCGGCAGTTCGCATCTCAAA
>probe:Drosophila_2:1637215_at:617:683; Interrogation_Position=673; Antisense; TATCCGAATCCATGACCGAGACTGA
>probe:Drosophila_2:1637215_at:273:41; Interrogation_Position=720; Antisense; ATCGGACCACACACCAAGATGTATT
>probe:Drosophila_2:1637215_at:673:181; Interrogation_Position=757; Antisense; AAAACAGCGGCCTCTGCAAGGGATT
>probe:Drosophila_2:1637215_at:39:119; Interrogation_Position=815; Antisense; AGCTGCCGCCATTGAGGTTCTTAAT
>probe:Drosophila_2:1637215_at:647:593; Interrogation_Position=827; Antisense; TGAGGTTCTTAATGGCCACGGCTAC
>probe:Drosophila_2:1637215_at:170:607; Interrogation_Position=859; Antisense; TGATCCTCTGCGTCGAGTGGTCCAA

Paste this into a BLAST search page for me
ATCTTTATGCAATTCATCGGCTCCAAAGAACATCGCCAAGTGCCGCATTTAGTGCCGCATTTGCAATGGCGAACAGAGTGTCAATTGTCCCTACAAGGGCACAAGGGCACCTCGATGGATAGCAAGCAGCTGCCGCTATAAGTGATCCCAAAATATGTACCACCCTTCATGAAGGATTCGTCGGCAGTTCGCATCTCAAATATCCGAATCCATGACCGAGACTGAATCGGACCACACACCAAGATGTATTAAAACAGCGGCCTCTGCAAGGGATTAGCTGCCGCCATTGAGGTTCTTAATTGAGGTTCTTAATGGCCACGGCTACTGATCCTCTGCGTCGAGTGGTCCAA

Full Affymetrix probeset data:

Annotations for 1637215_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime