FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637216_at:

>probe:Drosophila_2:1637216_at:359:557; Interrogation_Position=1008; Antisense; GGACAGTTTCATGGCGGGATTCATC
>probe:Drosophila_2:1637216_at:535:653; Interrogation_Position=1043; Antisense; TCAAGGCTCGTCGAAGTCTAGCGGA
>probe:Drosophila_2:1637216_at:296:549; Interrogation_Position=1065; Antisense; GGAGGCTGTTGACTTTGCCAACCGA
>probe:Drosophila_2:1637216_at:516:311; Interrogation_Position=1081; Antisense; GCCAACCGAGTTGCCAGTCACAAAA
>probe:Drosophila_2:1637216_at:483:185; Interrogation_Position=1102; Antisense; AAAATCACTGGATTCGGCTACGAAC
>probe:Drosophila_2:1637216_at:653:385; Interrogation_Position=1123; Antisense; GAACACATTTCCCAGCTTAGCTTAA
>probe:Drosophila_2:1637216_at:251:137; Interrogation_Position=1279; Antisense; ACGTGCATCACGCTCAATTATGAAT
>probe:Drosophila_2:1637216_at:477:71; Interrogation_Position=720; Antisense; AGGCATCATTATCTCGTTGGACTTC
>probe:Drosophila_2:1637216_at:379:175; Interrogation_Position=762; Antisense; AAACCAGGAATTGTGTGCGCCCTGC
>probe:Drosophila_2:1637216_at:669:327; Interrogation_Position=785; Antisense; GCGATTTTGTGGTCTTCTCCAAGGA
>probe:Drosophila_2:1637216_at:709:87; Interrogation_Position=845; Antisense; AGTCGTGCGAGGAGTTGGCCTCCAA
>probe:Drosophila_2:1637216_at:173:691; Interrogation_Position=859; Antisense; TTGGCCTCCAAAATTCCCGAAGGTG
>probe:Drosophila_2:1637216_at:121:223; Interrogation_Position=878; Antisense; AAGGTGGTCCAAAGCCTGTCTTCAT
>probe:Drosophila_2:1637216_at:607:157; Interrogation_Position=980; Antisense; ACAAGGTAGTTGACACGCTGGGAGC

Paste this into a BLAST search page for me
GGACAGTTTCATGGCGGGATTCATCTCAAGGCTCGTCGAAGTCTAGCGGAGGAGGCTGTTGACTTTGCCAACCGAGCCAACCGAGTTGCCAGTCACAAAAAAAATCACTGGATTCGGCTACGAACGAACACATTTCCCAGCTTAGCTTAAACGTGCATCACGCTCAATTATGAATAGGCATCATTATCTCGTTGGACTTCAAACCAGGAATTGTGTGCGCCCTGCGCGATTTTGTGGTCTTCTCCAAGGAAGTCGTGCGAGGAGTTGGCCTCCAATTGGCCTCCAAAATTCCCGAAGGTGAAGGTGGTCCAAAGCCTGTCTTCATACAAGGTAGTTGACACGCTGGGAGC

Full Affymetrix probeset data:

Annotations for 1637216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720