Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637217_at:

>probe:Drosophila_2:1637217_at:212:211; Interrogation_Position=1594; Antisense; AAGAAGAATCCCTCCATGCGCAAGG
>probe:Drosophila_2:1637217_at:583:435; Interrogation_Position=1648; Antisense; GAGGAACCGGACAGCACCCATGTGC
>probe:Drosophila_2:1637217_at:58:133; Interrogation_Position=1663; Antisense; ACCCATGTGCGGAATTTCCTGGATT
>probe:Drosophila_2:1637217_at:554:693; Interrogation_Position=1678; Antisense; TTCCTGGATTTCGTAATACCCGAGG
>probe:Drosophila_2:1637217_at:607:25; Interrogation_Position=1693; Antisense; ATACCCGAGGACAACTGGGACTCCA
>probe:Drosophila_2:1637217_at:216:629; Interrogation_Position=1714; Antisense; TCCACCTCGGAGATGAGCGACTACG
>probe:Drosophila_2:1637217_at:384:643; Interrogation_Position=1764; Antisense; TCTAAATGCACTTTCTGGAGGCGGC
>probe:Drosophila_2:1637217_at:194:597; Interrogation_Position=1791; Antisense; TGTGTTCCCACTCGATCGACAGATT
>probe:Drosophila_2:1637217_at:136:99; Interrogation_Position=1832; Antisense; AGATGGACCGCGAGTTGGCTCAGAC
>probe:Drosophila_2:1637217_at:627:581; Interrogation_Position=1847; Antisense; TGGCTCAGACCAGCGTGGGCAAGTC
>probe:Drosophila_2:1637217_at:377:593; Interrogation_Position=1862; Antisense; TGGGCAAGTCCTTCCACGGCAAGAA
>probe:Drosophila_2:1637217_at:321:457; Interrogation_Position=1981; Antisense; GATAGCTACCAATCGCAGGTTGGCG
>probe:Drosophila_2:1637217_at:619:77; Interrogation_Position=2010; Antisense; AGGTCCTGTATCCAATCTGTTTAGC
>probe:Drosophila_2:1637217_at:613:77; Interrogation_Position=2078; Antisense; AGGATATATCTGAGTCGGCCGTTTA

Paste this into a BLAST search page for me
AAGAAGAATCCCTCCATGCGCAAGGGAGGAACCGGACAGCACCCATGTGCACCCATGTGCGGAATTTCCTGGATTTTCCTGGATTTCGTAATACCCGAGGATACCCGAGGACAACTGGGACTCCATCCACCTCGGAGATGAGCGACTACGTCTAAATGCACTTTCTGGAGGCGGCTGTGTTCCCACTCGATCGACAGATTAGATGGACCGCGAGTTGGCTCAGACTGGCTCAGACCAGCGTGGGCAAGTCTGGGCAAGTCCTTCCACGGCAAGAAGATAGCTACCAATCGCAGGTTGGCGAGGTCCTGTATCCAATCTGTTTAGCAGGATATATCTGAGTCGGCCGTTTA

Full Affymetrix probeset data:

Annotations for 1637217_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime