FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637219_at:

>probe:Drosophila_2:1637219_at:321:617; Interrogation_Position=1010; Antisense; TGCTTGTTGTTACCGTATCACTCGC
>probe:Drosophila_2:1637219_at:80:673; Interrogation_Position=551; Antisense; TACCGCTACACCCTGGACGAGATGA
>probe:Drosophila_2:1637219_at:192:613; Interrogation_Position=573; Antisense; TGAAAAGCTTCAACCCATACCGTTT
>probe:Drosophila_2:1637219_at:258:177; Interrogation_Position=620; Antisense; AAACGTCCCAAATAGCCGTCATAGA
>probe:Drosophila_2:1637219_at:566:25; Interrogation_Position=640; Antisense; ATAGACGTCATAGCCGTCACACTTT
>probe:Drosophila_2:1637219_at:218:303; Interrogation_Position=684; Antisense; CCGTCAGCACCTCAATATTCAAGTT
>probe:Drosophila_2:1637219_at:629:115; Interrogation_Position=763; Antisense; AGCTTATAGGTTTATCTTGCATGCC
>probe:Drosophila_2:1637219_at:576:71; Interrogation_Position=819; Antisense; AGGAACCCAGGACACTGCCCATTTG
>probe:Drosophila_2:1637219_at:22:469; Interrogation_Position=850; Antisense; GTTGCCGTATTTCCATGTAGACTCA
>probe:Drosophila_2:1637219_at:546:211; Interrogation_Position=881; Antisense; AAGACTAGCACTAACTTCGCCACTA
>probe:Drosophila_2:1637219_at:389:305; Interrogation_Position=900; Antisense; CCACTACTTCCACAATTTCACATTA
>probe:Drosophila_2:1637219_at:515:461; Interrogation_Position=932; Antisense; GATTATATGGACATCGTGCATGCCT
>probe:Drosophila_2:1637219_at:458:639; Interrogation_Position=945; Antisense; TCGTGCATGCCTCCAAAGCGTATTG
>probe:Drosophila_2:1637219_at:383:399; Interrogation_Position=997; Antisense; GACACGGCTCATTTGCTTGTTGTTA

Paste this into a BLAST search page for me
TGCTTGTTGTTACCGTATCACTCGCTACCGCTACACCCTGGACGAGATGATGAAAAGCTTCAACCCATACCGTTTAAACGTCCCAAATAGCCGTCATAGAATAGACGTCATAGCCGTCACACTTTCCGTCAGCACCTCAATATTCAAGTTAGCTTATAGGTTTATCTTGCATGCCAGGAACCCAGGACACTGCCCATTTGGTTGCCGTATTTCCATGTAGACTCAAAGACTAGCACTAACTTCGCCACTACCACTACTTCCACAATTTCACATTAGATTATATGGACATCGTGCATGCCTTCGTGCATGCCTCCAAAGCGTATTGGACACGGCTCATTTGCTTGTTGTTA

Full Affymetrix probeset data:

Annotations for 1637219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720