FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637221_at:

>probe:Drosophila_2:1637221_at:258:371; Interrogation_Position=1050; Antisense; GAAGGCGCAACAGGGTAGTCTCAAT
>probe:Drosophila_2:1637221_at:655:83; Interrogation_Position=1085; Antisense; AGATCCGTACCTACAATTTCGTCCA
>probe:Drosophila_2:1637221_at:620:695; Interrogation_Position=1101; Antisense; TTTCGTCCAGGACCGCATAACGGAT
>probe:Drosophila_2:1637221_at:448:141; Interrogation_Position=1120; Antisense; ACGGATCATCGAATTCAAGGCGGTA
>probe:Drosophila_2:1637221_at:388:539; Interrogation_Position=1141; Antisense; GGTACGCTGCACAACCTCAATGGTT
>probe:Drosophila_2:1637221_at:133:249; Interrogation_Position=1158; Antisense; CAATGGTTTCCTCAAGGGCGGCGAC
>probe:Drosophila_2:1637221_at:540:331; Interrogation_Position=1175; Antisense; GCGGCGACCAACTGAGTGGACTAAT
>probe:Drosophila_2:1637221_at:478:409; Interrogation_Position=1290; Antisense; GAGCTACTTTCGTTTGTTACTACAT
>probe:Drosophila_2:1637221_at:602:473; Interrogation_Position=1305; Antisense; GTTACTACATTTATACGCCTGTGTT
>probe:Drosophila_2:1637221_at:555:557; Interrogation_Position=868; Antisense; GGACAGCATGTTAACACCACCGACT
>probe:Drosophila_2:1637221_at:237:309; Interrogation_Position=884; Antisense; CCACCGACTCGGCTGTAAGAATTGT
>probe:Drosophila_2:1637221_at:665:491; Interrogation_Position=898; Antisense; GTAAGAATTGTTCATCTGCCCACGG
>probe:Drosophila_2:1637221_at:348:115; Interrogation_Position=971; Antisense; AGCTAGCGATGAAGCGTCTACGGTC
>probe:Drosophila_2:1637221_at:59:671; Interrogation_Position=989; Antisense; TACGGTCGCGACTTGTGCAACAGCA

Paste this into a BLAST search page for me
GAAGGCGCAACAGGGTAGTCTCAATAGATCCGTACCTACAATTTCGTCCATTTCGTCCAGGACCGCATAACGGATACGGATCATCGAATTCAAGGCGGTAGGTACGCTGCACAACCTCAATGGTTCAATGGTTTCCTCAAGGGCGGCGACGCGGCGACCAACTGAGTGGACTAATGAGCTACTTTCGTTTGTTACTACATGTTACTACATTTATACGCCTGTGTTGGACAGCATGTTAACACCACCGACTCCACCGACTCGGCTGTAAGAATTGTGTAAGAATTGTTCATCTGCCCACGGAGCTAGCGATGAAGCGTCTACGGTCTACGGTCGCGACTTGTGCAACAGCA

Full Affymetrix probeset data:

Annotations for 1637221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720