FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637224_at:

>probe:Drosophila_2:1637224_at:266:423; Interrogation_Position=157; Antisense; GAGAAGCTGGTTCAGACCTACCTCC
>probe:Drosophila_2:1637224_at:457:513; Interrogation_Position=205; Antisense; GTGATCAGAGCCATTAACTCCCTAC
>probe:Drosophila_2:1637224_at:708:11; Interrogation_Position=240; Antisense; ATTCTACCGCCAGTTGATCAACCAA
>probe:Drosophila_2:1637224_at:242:111; Interrogation_Position=299; Antisense; AGCAATTGATCCTGTCCGGCGGTGG
>probe:Drosophila_2:1637224_at:110:575; Interrogation_Position=316; Antisense; GGCGGTGGACCCAAAATCTTTGATT
>probe:Drosophila_2:1637224_at:299:251; Interrogation_Position=369; Antisense; CAAGTATCCCTATTGGTCGCAGATC
>probe:Drosophila_2:1637224_at:484:205; Interrogation_Position=416; Antisense; AAGCGGAGTTCGTGCAGATCTACCC
>probe:Drosophila_2:1637224_at:545:359; Interrogation_Position=444; Antisense; GCAACTGATCCGATCCTTTCTGGAA
>probe:Drosophila_2:1637224_at:215:219; Interrogation_Position=486; Antisense; AAGTCCTCAACTGTCGGAACTCTGG
>probe:Drosophila_2:1637224_at:51:581; Interrogation_Position=521; Antisense; TGGCCTTGCGTCCAGTTTACGAAAG
>probe:Drosophila_2:1637224_at:141:677; Interrogation_Position=617; Antisense; TAGACGCCCTTATCCGTTATCAGTT
>probe:Drosophila_2:1637224_at:624:89; Interrogation_Position=638; Antisense; AGTTCGGTTGGAGCAACGTCACCTT
>probe:Drosophila_2:1637224_at:714:129; Interrogation_Position=658; Antisense; ACCTTTCCGAGCTACGATTACACAG
>probe:Drosophila_2:1637224_at:308:387; Interrogation_Position=99; Antisense; GAACAACTTTGCCTTGGAGCTGAAG

Paste this into a BLAST search page for me
GAGAAGCTGGTTCAGACCTACCTCCGTGATCAGAGCCATTAACTCCCTACATTCTACCGCCAGTTGATCAACCAAAGCAATTGATCCTGTCCGGCGGTGGGGCGGTGGACCCAAAATCTTTGATTCAAGTATCCCTATTGGTCGCAGATCAAGCGGAGTTCGTGCAGATCTACCCGCAACTGATCCGATCCTTTCTGGAAAAGTCCTCAACTGTCGGAACTCTGGTGGCCTTGCGTCCAGTTTACGAAAGTAGACGCCCTTATCCGTTATCAGTTAGTTCGGTTGGAGCAACGTCACCTTACCTTTCCGAGCTACGATTACACAGGAACAACTTTGCCTTGGAGCTGAAG

Full Affymetrix probeset data:

Annotations for 1637224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720