FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637225_at:

>probe:Drosophila_2:1637225_at:680:337; Interrogation_Position=3366; Antisense; GCTCTACTACGATTTCCTGTGTCTG
>probe:Drosophila_2:1637225_at:488:671; Interrogation_Position=3373; Antisense; TACGATTTCCTGTGTCTGCAGCTAA
>probe:Drosophila_2:1637225_at:709:515; Interrogation_Position=3384; Antisense; GTGTCTGCAGCTAATCGCCATGGTT
>probe:Drosophila_2:1637225_at:108:45; Interrogation_Position=3397; Antisense; ATCGCCATGGTTTTGCTCCGAAAAA
>probe:Drosophila_2:1637225_at:588:723; Interrogation_Position=3409; Antisense; TTGCTCCGAAAAAGAGCCATCCTGT
>probe:Drosophila_2:1637225_at:466:415; Interrogation_Position=3422; Antisense; GAGCCATCCTGTAAGAGGAGATCCT
>probe:Drosophila_2:1637225_at:491:99; Interrogation_Position=3435; Antisense; AGAGGAGATCCTACGATTTATCGTC
>probe:Drosophila_2:1637225_at:728:15; Interrogation_Position=3450; Antisense; ATTTATCGTCGAAACCAGATGTACC
>probe:Drosophila_2:1637225_at:88:501; Interrogation_Position=3457; Antisense; GTCGAAACCAGATGTACCACCGATC
>probe:Drosophila_2:1637225_at:410:261; Interrogation_Position=3474; Antisense; CACCGATCCACACAACAAAGCTAAA
>probe:Drosophila_2:1637225_at:76:167; Interrogation_Position=3496; Antisense; AAAGTTCCTGATCTTTAAGCATAAG
>probe:Drosophila_2:1637225_at:588:675; Interrogation_Position=3546; Antisense; TAGCATTTAGTATTTTCGTATTTAT
>probe:Drosophila_2:1637225_at:529:423; Interrogation_Position=3587; Antisense; GAGAACACAAGAGAGCACTAAGCTA
>probe:Drosophila_2:1637225_at:730:419; Interrogation_Position=3599; Antisense; GAGCACTAAGCTAAACGTACTGTAA

Paste this into a BLAST search page for me
GCTCTACTACGATTTCCTGTGTCTGTACGATTTCCTGTGTCTGCAGCTAAGTGTCTGCAGCTAATCGCCATGGTTATCGCCATGGTTTTGCTCCGAAAAATTGCTCCGAAAAAGAGCCATCCTGTGAGCCATCCTGTAAGAGGAGATCCTAGAGGAGATCCTACGATTTATCGTCATTTATCGTCGAAACCAGATGTACCGTCGAAACCAGATGTACCACCGATCCACCGATCCACACAACAAAGCTAAAAAAGTTCCTGATCTTTAAGCATAAGTAGCATTTAGTATTTTCGTATTTATGAGAACACAAGAGAGCACTAAGCTAGAGCACTAAGCTAAACGTACTGTAA

Full Affymetrix probeset data:

Annotations for 1637225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720