FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637226_at:

>probe:Drosophila_2:1637226_at:308:711; Interrogation_Position=102; Antisense; TTCTCAGCGGACGTGAACGGCGTTC
>probe:Drosophila_2:1637226_at:202:1; Interrogation_Position=117; Antisense; AACGGCGTTCCCACGGAGATAGTGT
>probe:Drosophila_2:1637226_at:492:679; Interrogation_Position=136; Antisense; TAGTGTTCCACTGCTTTGCCAAGAA
>probe:Drosophila_2:1637226_at:601:713; Interrogation_Position=165; Antisense; TTCTTAGTCATAACGCAGCTCGGCA
>probe:Drosophila_2:1637226_at:452:215; Interrogation_Position=189; Antisense; AAGATTCCCGGCATCTACAACGTGC
>probe:Drosophila_2:1637226_at:567:213; Interrogation_Position=236; Antisense; AAGAGTGGTTCCCTATTTGCACGGA
>probe:Drosophila_2:1637226_at:300:427; Interrogation_Position=276; Antisense; GAGTTCCACGTATCGGTGCCAATCA
>probe:Drosophila_2:1637226_at:460:239; Interrogation_Position=296; Antisense; AATCACGATGAACTGCTGCTTGGGC
>probe:Drosophila_2:1637226_at:195:619; Interrogation_Position=312; Antisense; TGCTTGGGCTTGGACACCGACGAGA
>probe:Drosophila_2:1637226_at:539:353; Interrogation_Position=340; Antisense; GCAGCGCCATACAGTTTCTGGTCAA
>probe:Drosophila_2:1637226_at:718:385; Interrogation_Position=419; Antisense; GAAAATCGACGGACCCAATCTTCGT
>probe:Drosophila_2:1637226_at:463:505; Interrogation_Position=442; Antisense; GTGCCCTAGCTAAGGTCCTCGAGGA
>probe:Drosophila_2:1637226_at:284:293; Interrogation_Position=469; Antisense; CGTTATTCTAGTCTGCGTTCGTTAT
>probe:Drosophila_2:1637226_at:36:43; Interrogation_Position=84; Antisense; ATCGGATTCGACAGGCAGTTCTCAG

Paste this into a BLAST search page for me
TTCTCAGCGGACGTGAACGGCGTTCAACGGCGTTCCCACGGAGATAGTGTTAGTGTTCCACTGCTTTGCCAAGAATTCTTAGTCATAACGCAGCTCGGCAAAGATTCCCGGCATCTACAACGTGCAAGAGTGGTTCCCTATTTGCACGGAGAGTTCCACGTATCGGTGCCAATCAAATCACGATGAACTGCTGCTTGGGCTGCTTGGGCTTGGACACCGACGAGAGCAGCGCCATACAGTTTCTGGTCAAGAAAATCGACGGACCCAATCTTCGTGTGCCCTAGCTAAGGTCCTCGAGGACGTTATTCTAGTCTGCGTTCGTTATATCGGATTCGACAGGCAGTTCTCAG

Full Affymetrix probeset data:

Annotations for 1637226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720