FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637228_at:

>probe:Drosophila_2:1637228_at:526:101; Interrogation_Position=1697; Antisense; AGAGCTATACACATCCCAACTTTGA
>probe:Drosophila_2:1637228_at:1:255; Interrogation_Position=1713; Antisense; CAACTTTGATAAGCGCACCGTGGAT
>probe:Drosophila_2:1637228_at:473:651; Interrogation_Position=1754; Antisense; TAAGGTTACCCAAGGCGGTCAATGC
>probe:Drosophila_2:1637228_at:524:537; Interrogation_Position=1770; Antisense; GGTCAATGCCACCACTTGGATTGGT
>probe:Drosophila_2:1637228_at:260:541; Interrogation_Position=1787; Antisense; GGATTGGTTACTCCTGTTTGCCGCA
>probe:Drosophila_2:1637228_at:367:269; Interrogation_Position=1819; Antisense; CAGGCGCTGCCCAAAAACGTGGATT
>probe:Drosophila_2:1637228_at:70:361; Interrogation_Position=1862; Antisense; GCAAGCGTCGCAATCGGGATGCCAC
>probe:Drosophila_2:1637228_at:581:243; Interrogation_Position=1936; Antisense; AATTGCCGCAAGGTTTACTACGATT
>probe:Drosophila_2:1637228_at:492:107; Interrogation_Position=1973; Antisense; AGAACATGTTTTGTGCCGGGCATCA
>probe:Drosophila_2:1637228_at:466:203; Interrogation_Position=2068; Antisense; AACCATCCGTGGACCATATTTGGCA
>probe:Drosophila_2:1637228_at:420:19; Interrogation_Position=2083; Antisense; ATATTTGGCATCACCTCGTTCGGCG
>probe:Drosophila_2:1637228_at:266:323; Interrogation_Position=2114; Antisense; GCGCCCAGCGCAATAAGTTTGGCAT
>probe:Drosophila_2:1637228_at:229:251; Interrogation_Position=2145; Antisense; CAAGGTGCCCAACTACGTGGACTGG
>probe:Drosophila_2:1637228_at:176:501; Interrogation_Position=2175; Antisense; GTCGGTTGTCAACTGCGATGGCAAC

Paste this into a BLAST search page for me
AGAGCTATACACATCCCAACTTTGACAACTTTGATAAGCGCACCGTGGATTAAGGTTACCCAAGGCGGTCAATGCGGTCAATGCCACCACTTGGATTGGTGGATTGGTTACTCCTGTTTGCCGCACAGGCGCTGCCCAAAAACGTGGATTGCAAGCGTCGCAATCGGGATGCCACAATTGCCGCAAGGTTTACTACGATTAGAACATGTTTTGTGCCGGGCATCAAACCATCCGTGGACCATATTTGGCAATATTTGGCATCACCTCGTTCGGCGGCGCCCAGCGCAATAAGTTTGGCATCAAGGTGCCCAACTACGTGGACTGGGTCGGTTGTCAACTGCGATGGCAAC

Full Affymetrix probeset data:

Annotations for 1637228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720