Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637229_a_at:

>probe:Drosophila_2:1637229_a_at:53:191; Interrogation_Position=1064; Antisense; AACATTTTGATTGACTTCGACGAGA
>probe:Drosophila_2:1637229_a_at:69:409; Interrogation_Position=1082; Antisense; GACGAGAACGGATATCTGCTGCAGA
>probe:Drosophila_2:1637229_a_at:421:39; Interrogation_Position=1095; Antisense; ATCTGCTGCAGATCTTCACAAAGAA
>probe:Drosophila_2:1637229_a_at:7:95; Interrogation_Position=1116; Antisense; AGAACTGCCAGGATAGACCGACCCT
>probe:Drosophila_2:1637229_a_at:564:411; Interrogation_Position=1135; Antisense; GACCCTCTTCCTGGAAGTTATCCAA
>probe:Drosophila_2:1637229_a_at:41:93; Interrogation_Position=1150; Antisense; AGTTATCCAACGCTACAATCACAAT
>probe:Drosophila_2:1637229_a_at:720:727; Interrogation_Position=1179; Antisense; TTGGCGCTGGCAACTTTAAGTCCTT
>probe:Drosophila_2:1637229_a_at:631:203; Interrogation_Position=1196; Antisense; AAGTCCTTGTTCACGGCCATTGAAA
>probe:Drosophila_2:1637229_a_at:552:341; Interrogation_Position=726; Antisense; GCTTCTGGTCCGTGGATGACTCGCA
>probe:Drosophila_2:1637229_a_at:241:445; Interrogation_Position=740; Antisense; GATGACTCGCAGATTCACACGGAAT
>probe:Drosophila_2:1637229_a_at:503:447; Interrogation_Position=814; Antisense; GATGCCGATCAATGAGCCAGCCAAT
>probe:Drosophila_2:1637229_a_at:276:113; Interrogation_Position=897; Antisense; AGCACATTGCTCTTAATACGGATGA
>probe:Drosophila_2:1637229_a_at:368:15; Interrogation_Position=923; Antisense; ATTATCGAGGCGGTGAGCAACCTAA
>probe:Drosophila_2:1637229_a_at:311:281; Interrogation_Position=982; Antisense; CTCGTACTACGAGATCCTTCAGGAG

Paste this into a BLAST search page for me
AACATTTTGATTGACTTCGACGAGAGACGAGAACGGATATCTGCTGCAGAATCTGCTGCAGATCTTCACAAAGAAAGAACTGCCAGGATAGACCGACCCTGACCCTCTTCCTGGAAGTTATCCAAAGTTATCCAACGCTACAATCACAATTTGGCGCTGGCAACTTTAAGTCCTTAAGTCCTTGTTCACGGCCATTGAAAGCTTCTGGTCCGTGGATGACTCGCAGATGACTCGCAGATTCACACGGAATGATGCCGATCAATGAGCCAGCCAATAGCACATTGCTCTTAATACGGATGAATTATCGAGGCGGTGAGCAACCTAACTCGTACTACGAGATCCTTCAGGAG

Full Affymetrix probeset data:

Annotations for 1637229_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime