FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637232_at:

>probe:Drosophila_2:1637232_at:709:637; Interrogation_Position=121; Antisense; TCATATCGTGATAGGGTTTCCCGGG
>probe:Drosophila_2:1637232_at:492:641; Interrogation_Position=353; Antisense; TCTCCGACGCACAGGTGAGTTAACT
>probe:Drosophila_2:1637232_at:306:257; Interrogation_Position=362; Antisense; CACAGGTGAGTTAACTTGGTAACCA
>probe:Drosophila_2:1637232_at:656:677; Interrogation_Position=377; Antisense; TTGGTAACCAATGCTCGTAAAAACA
>probe:Drosophila_2:1637232_at:443:619; Interrogation_Position=388; Antisense; TGCTCGTAAAAACACCGATCGATTA
>probe:Drosophila_2:1637232_at:360:157; Interrogation_Position=399; Antisense; ACACCGATCGATTAGTGGATTGATG
>probe:Drosophila_2:1637232_at:382:683; Interrogation_Position=428; Antisense; TATGCAAATCCATCAGAATGGCGTT
>probe:Drosophila_2:1637232_at:83:35; Interrogation_Position=439; Antisense; ATCAGAATGGCGTTTTAATAAGGTT
>probe:Drosophila_2:1637232_at:476:221; Interrogation_Position=458; Antisense; AAGGTTGTAAATCGCCTCGTAATCA
>probe:Drosophila_2:1637232_at:10:237; Interrogation_Position=467; Antisense; AATCGCCTCGTAATCAAAACTTAGC
>probe:Drosophila_2:1637232_at:411:451; Interrogation_Position=477; Antisense; TAATCAAAACTTAGCCAGGGTAGGG
>probe:Drosophila_2:1637232_at:67:663; Interrogation_Position=515; Antisense; TAAAGACTCTACTTCGACTCTCTGA
>probe:Drosophila_2:1637232_at:638:403; Interrogation_Position=530; Antisense; GACTCTCTGACTTCGTGGTAATCTG
>probe:Drosophila_2:1637232_at:407:493; Interrogation_Position=547; Antisense; GTAATCTGAGTATGTAAATTGCCAA

Paste this into a BLAST search page for me
TCATATCGTGATAGGGTTTCCCGGGTCTCCGACGCACAGGTGAGTTAACTCACAGGTGAGTTAACTTGGTAACCATTGGTAACCAATGCTCGTAAAAACATGCTCGTAAAAACACCGATCGATTAACACCGATCGATTAGTGGATTGATGTATGCAAATCCATCAGAATGGCGTTATCAGAATGGCGTTTTAATAAGGTTAAGGTTGTAAATCGCCTCGTAATCAAATCGCCTCGTAATCAAAACTTAGCTAATCAAAACTTAGCCAGGGTAGGGTAAAGACTCTACTTCGACTCTCTGAGACTCTCTGACTTCGTGGTAATCTGGTAATCTGAGTATGTAAATTGCCAA

Full Affymetrix probeset data:

Annotations for 1637232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720