FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637233_at:

>probe:Drosophila_2:1637233_at:82:463; Interrogation_Position=1025; Antisense; GATTACAACAATCCCGCCAAATATG
>probe:Drosophila_2:1637233_at:213:659; Interrogation_Position=1108; Antisense; TAACGATCGGACTACCCTTTTGCTG
>probe:Drosophila_2:1637233_at:715:329; Interrogation_Position=1136; Antisense; GCGGTACTGGTTTTGTTTCTGATCA
>probe:Drosophila_2:1637233_at:684:723; Interrogation_Position=1148; Antisense; TTGTTTCTGATCACGGAGTTTCCGC
>probe:Drosophila_2:1637233_at:11:463; Interrogation_Position=1176; Antisense; GATTACTTGGTCTGCTGTCCGGAGT
>probe:Drosophila_2:1637233_at:377:441; Interrogation_Position=1201; Antisense; GATGGAGAAGTGCTTCTTCGCCCAC
>probe:Drosophila_2:1637233_at:112:279; Interrogation_Position=1228; Antisense; CTATCCGCCGTTTGGAGAGCTGATG
>probe:Drosophila_2:1637233_at:92:441; Interrogation_Position=1249; Antisense; GATGGATCTGCTGGCACTGATCAAC
>probe:Drosophila_2:1637233_at:608:291; Interrogation_Position=1288; Antisense; CGTGCTGTACGGTCTGATGTCGAAA
>probe:Drosophila_2:1637233_at:628:429; Interrogation_Position=1303; Antisense; GATGTCGAAACAGTTCCGGACCACC
>probe:Drosophila_2:1637233_at:142:567; Interrogation_Position=1350; Antisense; GGCACTTTGGCAGCACCGAAATGAC
>probe:Drosophila_2:1637233_at:66:137; Interrogation_Position=1394; Antisense; ACGACTTGCGTCTAGTTGGGCACAT
>probe:Drosophila_2:1637233_at:728:631; Interrogation_Position=1489; Antisense; TCCGGCCCGGCATTGAATTTGAATT
>probe:Drosophila_2:1637233_at:54:73; Interrogation_Position=996; Antisense; AGGCATCGAGACGTCGCTTGAAGCT

Paste this into a BLAST search page for me
GATTACAACAATCCCGCCAAATATGTAACGATCGGACTACCCTTTTGCTGGCGGTACTGGTTTTGTTTCTGATCATTGTTTCTGATCACGGAGTTTCCGCGATTACTTGGTCTGCTGTCCGGAGTGATGGAGAAGTGCTTCTTCGCCCACCTATCCGCCGTTTGGAGAGCTGATGGATGGATCTGCTGGCACTGATCAACCGTGCTGTACGGTCTGATGTCGAAAGATGTCGAAACAGTTCCGGACCACCGGCACTTTGGCAGCACCGAAATGACACGACTTGCGTCTAGTTGGGCACATTCCGGCCCGGCATTGAATTTGAATTAGGCATCGAGACGTCGCTTGAAGCT

Full Affymetrix probeset data:

Annotations for 1637233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720