FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637236_at:

>probe:Drosophila_2:1637236_at:228:429; Interrogation_Position=370; Antisense; GAGTTTCGAATATGCCCAAATCCAA
>probe:Drosophila_2:1637236_at:104:495; Interrogation_Position=429; Antisense; GTCAATTCTTAATGGATCTCCTTCT
>probe:Drosophila_2:1637236_at:521:545; Interrogation_Position=442; Antisense; GGATCTCCTTCTCAGCCAAATGAAT
>probe:Drosophila_2:1637236_at:549:231; Interrogation_Position=460; Antisense; AATGAATCAGACCTAGATACCCGAT
>probe:Drosophila_2:1637236_at:658:453; Interrogation_Position=475; Antisense; GATACCCGATTTTATCCTCGAAACG
>probe:Drosophila_2:1637236_at:252:703; Interrogation_Position=518; Antisense; TTTTGGCACAGTTACCAGGCGTGGC
>probe:Drosophila_2:1637236_at:539:267; Interrogation_Position=533; Antisense; CAGGCGTGGCAACATGGATCAACTT
>probe:Drosophila_2:1637236_at:529:65; Interrogation_Position=546; Antisense; ATGGATCAACTTGGGCTGCGTCTAT
>probe:Drosophila_2:1637236_at:522:335; Interrogation_Position=560; Antisense; GCTGCGTCTATGTCTCTAGAATCTG
>probe:Drosophila_2:1637236_at:78:203; Interrogation_Position=595; Antisense; AACCTTCTAGCCTTTAATGATCCTG
>probe:Drosophila_2:1637236_at:235:449; Interrogation_Position=613; Antisense; GATCCTGAGATCGAGGCGTTCATTC
>probe:Drosophila_2:1637236_at:542:579; Interrogation_Position=660; Antisense; GGCCAGATCGGCGTGGCTATTGATC
>probe:Drosophila_2:1637236_at:493:343; Interrogation_Position=704; Antisense; GCTTCCTTACATACATGCGTGTTAC
>probe:Drosophila_2:1637236_at:234:271; Interrogation_Position=732; Antisense; CATTTTCACGAATCTAGCCTTTTAT

Paste this into a BLAST search page for me
GAGTTTCGAATATGCCCAAATCCAAGTCAATTCTTAATGGATCTCCTTCTGGATCTCCTTCTCAGCCAAATGAATAATGAATCAGACCTAGATACCCGATGATACCCGATTTTATCCTCGAAACGTTTTGGCACAGTTACCAGGCGTGGCCAGGCGTGGCAACATGGATCAACTTATGGATCAACTTGGGCTGCGTCTATGCTGCGTCTATGTCTCTAGAATCTGAACCTTCTAGCCTTTAATGATCCTGGATCCTGAGATCGAGGCGTTCATTCGGCCAGATCGGCGTGGCTATTGATCGCTTCCTTACATACATGCGTGTTACCATTTTCACGAATCTAGCCTTTTAT

Full Affymetrix probeset data:

Annotations for 1637236_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720