Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637239_s_at:

>probe:Drosophila_2:1637239_s_at:49:389; Interrogation_Position=140; Antisense; GAAAATGCTTAACCTACGGCTCACG
>probe:Drosophila_2:1637239_s_at:355:669; Interrogation_Position=154; Antisense; TACGGCTCACGTTGTGGCTATCCTG
>probe:Drosophila_2:1637239_s_at:140:293; Interrogation_Position=17; Antisense; CGTCGATTTCTACGATCATTGGATT
>probe:Drosophila_2:1637239_s_at:600:47; Interrogation_Position=173; Antisense; ATCCTGCGCACCGTCTTAAAGAAAC
>probe:Drosophila_2:1637239_s_at:206:505; Interrogation_Position=274; Antisense; GGTCTACCTAGTGAGTCAGAACCAT
>probe:Drosophila_2:1637239_s_at:421:249; Interrogation_Position=337; Antisense; CACAATGTTGGTGAACCCGTCGGAT
>probe:Drosophila_2:1637239_s_at:580:113; Interrogation_Position=395; Antisense; AGCAGCTTAATCCTCTCAACCAGGA
>probe:Drosophila_2:1637239_s_at:631:515; Interrogation_Position=42; Antisense; GTGTCTTTTGTTCTTTATGCTGAGC
>probe:Drosophila_2:1637239_s_at:633:59; Interrogation_Position=430; Antisense; ATGTTCACCAACATGTTTCTCAGCC
>probe:Drosophila_2:1637239_s_at:478:697; Interrogation_Position=445; Antisense; TTTCTCAGCCTGTTTCGCGGAGTAG
>probe:Drosophila_2:1637239_s_at:398:331; Interrogation_Position=461; Antisense; GCGGAGTAGCCGACTATCGAAACAT
>probe:Drosophila_2:1637239_s_at:449:189; Interrogation_Position=481; Antisense; AACATGGTGGCTGCCGATTCAGTGC
>probe:Drosophila_2:1637239_s_at:546:265; Interrogation_Position=517; Antisense; CAGAGTCCGCCAGTTGTTGACTTTA
>probe:Drosophila_2:1637239_s_at:467:467; Interrogation_Position=532; Antisense; GTTGACTTTAGTCACCGACTCTTTG

Paste this into a BLAST search page for me
GAAAATGCTTAACCTACGGCTCACGTACGGCTCACGTTGTGGCTATCCTGCGTCGATTTCTACGATCATTGGATTATCCTGCGCACCGTCTTAAAGAAACGGTCTACCTAGTGAGTCAGAACCATCACAATGTTGGTGAACCCGTCGGATAGCAGCTTAATCCTCTCAACCAGGAGTGTCTTTTGTTCTTTATGCTGAGCATGTTCACCAACATGTTTCTCAGCCTTTCTCAGCCTGTTTCGCGGAGTAGGCGGAGTAGCCGACTATCGAAACATAACATGGTGGCTGCCGATTCAGTGCCAGAGTCCGCCAGTTGTTGACTTTAGTTGACTTTAGTCACCGACTCTTTG

Full Affymetrix probeset data:

Annotations for 1637239_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime