FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637244_at:

>probe:Drosophila_2:1637244_at:674:291; Interrogation_Position=2037; Antisense; CGTCGACCTGCAGTTCTACAATGAA
>probe:Drosophila_2:1637244_at:673:365; Interrogation_Position=2059; Antisense; GAATCTTCGCTATCGATACTGGCCC
>probe:Drosophila_2:1637244_at:138:29; Interrogation_Position=2074; Antisense; ATACTGGCCCAGTCCATAAATGCGG
>probe:Drosophila_2:1637244_at:137:663; Interrogation_Position=2090; Antisense; TAAATGCGGGACCTGGCATGCGACC
>probe:Drosophila_2:1637244_at:2:327; Interrogation_Position=2109; Antisense; GCGACCGCATAGCTTCTTTATACAA
>probe:Drosophila_2:1637244_at:369:699; Interrogation_Position=2125; Antisense; TTTATACAATTCTCACTGACCGCGG
>probe:Drosophila_2:1637244_at:719:13; Interrogation_Position=2156; Antisense; ATTACAGCACACAGCACCGAATGGG
>probe:Drosophila_2:1637244_at:146:413; Interrogation_Position=2180; Antisense; GACCGTTGGTCAAGCTGAGCGAAGC
>probe:Drosophila_2:1637244_at:577:609; Interrogation_Position=2195; Antisense; TGAGCGAAGCCACCGTGTCGCAAAG
>probe:Drosophila_2:1637244_at:218:49; Interrogation_Position=2221; Antisense; ATCCATGACATTGCCGATGGTGCCG
>probe:Drosophila_2:1637244_at:420:297; Interrogation_Position=2244; Antisense; CGCCTTCAAGGGACTGGACGGATTT
>probe:Drosophila_2:1637244_at:145:451; Interrogation_Position=2320; Antisense; GATCGCAAGCGCAAGATGACCATTT
>probe:Drosophila_2:1637244_at:612:69; Interrogation_Position=2390; Antisense; AGGCCTCGTTTCTGGACATCAGCAA
>probe:Drosophila_2:1637244_at:668:255; Interrogation_Position=2412; Antisense; CAAAGAGTCTGTGCTGGCTGGCGTT

Paste this into a BLAST search page for me
CGTCGACCTGCAGTTCTACAATGAAGAATCTTCGCTATCGATACTGGCCCATACTGGCCCAGTCCATAAATGCGGTAAATGCGGGACCTGGCATGCGACCGCGACCGCATAGCTTCTTTATACAATTTATACAATTCTCACTGACCGCGGATTACAGCACACAGCACCGAATGGGGACCGTTGGTCAAGCTGAGCGAAGCTGAGCGAAGCCACCGTGTCGCAAAGATCCATGACATTGCCGATGGTGCCGCGCCTTCAAGGGACTGGACGGATTTGATCGCAAGCGCAAGATGACCATTTAGGCCTCGTTTCTGGACATCAGCAACAAAGAGTCTGTGCTGGCTGGCGTT

Full Affymetrix probeset data:

Annotations for 1637244_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720