FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637249_at:

>probe:Drosophila_2:1637249_at:501:125; Interrogation_Position=1023; Antisense; AGCCGCAATGCACTGGTTCCAGATG
>probe:Drosophila_2:1637249_at:345:329; Interrogation_Position=1121; Antisense; GCGTGTACCAGGATTTCTGCTTCGA
>probe:Drosophila_2:1637249_at:597:619; Interrogation_Position=1138; Antisense; TGCTTCGAGCTCTTTGGCCACGTAA
>probe:Drosophila_2:1637249_at:361:147; Interrogation_Position=1167; Antisense; ACTTTTCGGATATCCTGTTGTCCTG
>probe:Drosophila_2:1637249_at:406:671; Interrogation_Position=1228; Antisense; TACGAAATTCTGGTGCGCTGCACGA
>probe:Drosophila_2:1637249_at:622:237; Interrogation_Position=1311; Antisense; AATCGGCAACACTGATCTCGCAGAG
>probe:Drosophila_2:1637249_at:339:423; Interrogation_Position=1342; Antisense; GAGAACCTCATCCTGAACGGCATTG
>probe:Drosophila_2:1637249_at:198:197; Interrogation_Position=1357; Antisense; AACGGCATTGATTTGGAGCCCTATG
>probe:Drosophila_2:1637249_at:674:415; Interrogation_Position=1372; Antisense; GAGCCCTATGGCGATGATATTCTTA
>probe:Drosophila_2:1637249_at:714:547; Interrogation_Position=839; Antisense; GGAGCTTTCAGCAGTTGACCTGTGA
>probe:Drosophila_2:1637249_at:426:411; Interrogation_Position=855; Antisense; GACCTGTGACTTTATTGTTTCCGCA
>probe:Drosophila_2:1637249_at:98:303; Interrogation_Position=892; Antisense; CCGAATACCGACTACACGTGTGATT
>probe:Drosophila_2:1637249_at:282:517; Interrogation_Position=909; Antisense; GTGTGATTCGCCACTTCAATTTTCC
>probe:Drosophila_2:1637249_at:457:365; Interrogation_Position=972; Antisense; GAATCTGGTGGATGTCTTTGCGGCC

Paste this into a BLAST search page for me
AGCCGCAATGCACTGGTTCCAGATGGCGTGTACCAGGATTTCTGCTTCGATGCTTCGAGCTCTTTGGCCACGTAAACTTTTCGGATATCCTGTTGTCCTGTACGAAATTCTGGTGCGCTGCACGAAATCGGCAACACTGATCTCGCAGAGGAGAACCTCATCCTGAACGGCATTGAACGGCATTGATTTGGAGCCCTATGGAGCCCTATGGCGATGATATTCTTAGGAGCTTTCAGCAGTTGACCTGTGAGACCTGTGACTTTATTGTTTCCGCACCGAATACCGACTACACGTGTGATTGTGTGATTCGCCACTTCAATTTTCCGAATCTGGTGGATGTCTTTGCGGCC

Full Affymetrix probeset data:

Annotations for 1637249_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720