FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637250_at:

>probe:Drosophila_2:1637250_at:725:493; Interrogation_Position=129; Antisense; GTCAAATCCCCGGAGCAGATCATAA
>probe:Drosophila_2:1637250_at:156:115; Interrogation_Position=142; Antisense; AGCAGATCATAATGCGCTCTCCTGA
>probe:Drosophila_2:1637250_at:565:583; Interrogation_Position=190; Antisense; TGGACACTGGCAAAACCTTCACGGT
>probe:Drosophila_2:1637250_at:405:173; Interrogation_Position=202; Antisense; AAACCTTCACGGTGACGCAGAATGT
>probe:Drosophila_2:1637250_at:165:529; Interrogation_Position=235; Antisense; GGGAGAACTACAGCCGACCTCAGAG
>probe:Drosophila_2:1637250_at:720:441; Interrogation_Position=24; Antisense; GATGGTCGTGAGACTGCCATTTCCA
>probe:Drosophila_2:1637250_at:671:1; Interrogation_Position=264; Antisense; ATTAAAGCGTCGACACCGGTGGAGA
>probe:Drosophila_2:1637250_at:593:39; Interrogation_Position=308; Antisense; ATCGGCTCCGCCACAATTAACCGAA
>probe:Drosophila_2:1637250_at:54:67; Interrogation_Position=342; Antisense; ATGGACGCCTGGAAGTCCTGCAGTC
>probe:Drosophila_2:1637250_at:551:627; Interrogation_Position=38; Antisense; TGCCATTTCCATTTCCAGCTGTAGT
>probe:Drosophila_2:1637250_at:231:297; Interrogation_Position=380; Antisense; CGCGATCTACGGCAAAACACTGACG
>probe:Drosophila_2:1637250_at:395:111; Interrogation_Position=475; Antisense; AGCAGCCGGATCCTGCGATGTCGTC
>probe:Drosophila_2:1637250_at:273:371; Interrogation_Position=557; Antisense; GAAGGCTCGCGACCGATTCGATCGA
>probe:Drosophila_2:1637250_at:289:437; Interrogation_Position=90; Antisense; GAGGAGCCCCTGGTGAAGTCGCCAC

Paste this into a BLAST search page for me
GTCAAATCCCCGGAGCAGATCATAAAGCAGATCATAATGCGCTCTCCTGATGGACACTGGCAAAACCTTCACGGTAAACCTTCACGGTGACGCAGAATGTGGGAGAACTACAGCCGACCTCAGAGGATGGTCGTGAGACTGCCATTTCCAATTAAAGCGTCGACACCGGTGGAGAATCGGCTCCGCCACAATTAACCGAAATGGACGCCTGGAAGTCCTGCAGTCTGCCATTTCCATTTCCAGCTGTAGTCGCGATCTACGGCAAAACACTGACGAGCAGCCGGATCCTGCGATGTCGTCGAAGGCTCGCGACCGATTCGATCGAGAGGAGCCCCTGGTGAAGTCGCCAC

Full Affymetrix probeset data:

Annotations for 1637250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720