Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637251_a_at:

>probe:Drosophila_2:1637251_a_at:334:481; Interrogation_Position=124; Antisense; GTATTCAGTTACCACCGCAGATCAG
>probe:Drosophila_2:1637251_a_at:328:351; Interrogation_Position=140; Antisense; GCAGATCAGCCAAGATGTCGTTCCT
>probe:Drosophila_2:1637251_a_at:461:441; Interrogation_Position=153; Antisense; GATGTCGTTCCTACTGAAAGCAGTT
>probe:Drosophila_2:1637251_a_at:469:611; Interrogation_Position=167; Antisense; TGAAAGCAGTTACCACAGCCCGTCA
>probe:Drosophila_2:1637251_a_at:233:125; Interrogation_Position=183; Antisense; AGCCCGTCACATCGTTCATAAGGTT
>probe:Drosophila_2:1637251_a_at:412:637; Interrogation_Position=194; Antisense; TCGTTCATAAGGTTCCCGTGCGCAA
>probe:Drosophila_2:1637251_a_at:556:623; Interrogation_Position=212; Antisense; TGCGCAACCTGAATCTGCTGGAGTT
>probe:Drosophila_2:1637251_a_at:683:421; Interrogation_Position=240; Antisense; GAGCAAGGATCTCCTCCAGAAGTAT
>probe:Drosophila_2:1637251_a_at:658:521; Interrogation_Position=268; Antisense; GTGGCCATACAGCAATTCAAGGTCT
>probe:Drosophila_2:1637251_a_at:544:659; Interrogation_Position=30; Antisense; TAAGCATCGTGGAACGGCGGCGATT
>probe:Drosophila_2:1637251_a_at:630:349; Interrogation_Position=307; Antisense; GCAGATGCCGAGGTCGTCAAGACTT
>probe:Drosophila_2:1637251_a_at:510:493; Interrogation_Position=322; Antisense; GTCAAGACTTTTGAGTGCCCGGAAT
>probe:Drosophila_2:1637251_a_at:352:575; Interrogation_Position=377; Antisense; GGCGTGGCAAGGGAACTTTCGACAA
>probe:Drosophila_2:1637251_a_at:533:195; Interrogation_Position=400; Antisense; AACGGATTCAAAGGCGGCGTCCATA

Paste this into a BLAST search page for me
GTATTCAGTTACCACCGCAGATCAGGCAGATCAGCCAAGATGTCGTTCCTGATGTCGTTCCTACTGAAAGCAGTTTGAAAGCAGTTACCACAGCCCGTCAAGCCCGTCACATCGTTCATAAGGTTTCGTTCATAAGGTTCCCGTGCGCAATGCGCAACCTGAATCTGCTGGAGTTGAGCAAGGATCTCCTCCAGAAGTATGTGGCCATACAGCAATTCAAGGTCTTAAGCATCGTGGAACGGCGGCGATTGCAGATGCCGAGGTCGTCAAGACTTGTCAAGACTTTTGAGTGCCCGGAATGGCGTGGCAAGGGAACTTTCGACAAAACGGATTCAAAGGCGGCGTCCATA

Full Affymetrix probeset data:

Annotations for 1637251_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime