Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637253_s_at:

>probe:Drosophila_2:1637253_s_at:580:507; Interrogation_Position=125; Antisense; GTGCGAACTTCATTTTCCATGCGAT
>probe:Drosophila_2:1637253_s_at:48:721; Interrogation_Position=139; Antisense; TTCCATGCGATCTCGAACTACAAGA
>probe:Drosophila_2:1637253_s_at:485:385; Interrogation_Position=18; Antisense; GAACATTGTCGCACTAAAGCTGAGC
>probe:Drosophila_2:1637253_s_at:297:183; Interrogation_Position=181; Antisense; AAAACGCTGGTCTTCATTGCCAAAA
>probe:Drosophila_2:1637253_s_at:352:153; Interrogation_Position=215; Antisense; ACATCCAGATGCTGTGGCGCGAGTT
>probe:Drosophila_2:1637253_s_at:406:157; Interrogation_Position=257; Antisense; AAATACGGCGGCTTGGCCACAAGGA
>probe:Drosophila_2:1637253_s_at:233:225; Interrogation_Position=277; Antisense; AAGGATGCACGCGTTCTGGAGCACG
>probe:Drosophila_2:1637253_s_at:387:567; Interrogation_Position=301; Antisense; GGCTACTTCCAGCAGGAACTCTTCG
>probe:Drosophila_2:1637253_s_at:576:383; Interrogation_Position=316; Antisense; GAACTCTTCGAGCTGGTCCACGAAA
>probe:Drosophila_2:1637253_s_at:314:217; Interrogation_Position=340; Antisense; AAGTATATGGTTGTCCGTGGATTCC
>probe:Drosophila_2:1637253_s_at:116:305; Interrogation_Position=354; Antisense; CCGTGGATTCCTGAGTCGTGACAAA
>probe:Drosophila_2:1637253_s_at:350:173; Interrogation_Position=377; Antisense; AAAGAAATCTGCTCGCTGGTCAGCC
>probe:Drosophila_2:1637253_s_at:368:591; Interrogation_Position=393; Antisense; TGGTCAGCCAGCAACACGGCCATAA
>probe:Drosophila_2:1637253_s_at:257:243; Interrogation_Position=82; Antisense; AATATCCTTGCGCTGGACCAATTGG

Paste this into a BLAST search page for me
GTGCGAACTTCATTTTCCATGCGATTTCCATGCGATCTCGAACTACAAGAGAACATTGTCGCACTAAAGCTGAGCAAAACGCTGGTCTTCATTGCCAAAAACATCCAGATGCTGTGGCGCGAGTTAAATACGGCGGCTTGGCCACAAGGAAAGGATGCACGCGTTCTGGAGCACGGGCTACTTCCAGCAGGAACTCTTCGGAACTCTTCGAGCTGGTCCACGAAAAAGTATATGGTTGTCCGTGGATTCCCCGTGGATTCCTGAGTCGTGACAAAAAAGAAATCTGCTCGCTGGTCAGCCTGGTCAGCCAGCAACACGGCCATAAAATATCCTTGCGCTGGACCAATTGG

Full Affymetrix probeset data:

Annotations for 1637253_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime