FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637254_at:

>probe:Drosophila_2:1637254_at:61:181; Interrogation_Position=1381; Antisense; AAACAGCTCCTATCCGCAGAAGATG
>probe:Drosophila_2:1637254_at:212:607; Interrogation_Position=1440; Antisense; TGATGCTCGTCTTGGGCAGCACCAT
>probe:Drosophila_2:1637254_at:215:605; Interrogation_Position=1488; Antisense; TGATAGCACACCTCGGAAAGTCCTT
>probe:Drosophila_2:1637254_at:607:393; Interrogation_Position=1503; Antisense; GAAAGTCCTTTTACCTGCAGTTTAG
>probe:Drosophila_2:1637254_at:147:593; Interrogation_Position=1551; Antisense; TGGGACTCGGCTTCCTGGGATTCAA
>probe:Drosophila_2:1637254_at:563:593; Interrogation_Position=1566; Antisense; TGGGATTCAAGTCGCGCCACTGCGA
>probe:Drosophila_2:1637254_at:20:27; Interrogation_Position=1611; Antisense; ATAGTTCCGGCTATATCCTGGTCAC
>probe:Drosophila_2:1637254_at:193:591; Interrogation_Position=1629; Antisense; TGGTCACCGTATTTTGCCTATTCAA
>probe:Drosophila_2:1637254_at:439:219; Interrogation_Position=1652; Antisense; AAGTCCTGCGGATTGCTTGTGATAC
>probe:Drosophila_2:1637254_at:56:721; Interrogation_Position=1668; Antisense; TTGTGATACTCGTGGTGGACCCCTT
>probe:Drosophila_2:1637254_at:685:543; Interrogation_Position=1697; Antisense; GGATTTCCTGTCCACGATGTGACCA
>probe:Drosophila_2:1637254_at:166:143; Interrogation_Position=1721; Antisense; ACTGGCGTCATCCTTGGACTGTCGA
>probe:Drosophila_2:1637254_at:206:599; Interrogation_Position=1740; Antisense; TGTCGACTTTCACCATGTTCTTCAT
>probe:Drosophila_2:1637254_at:529:105; Interrogation_Position=1810; Antisense; AGACAACCGCGTCAACGTGGTCTAA

Paste this into a BLAST search page for me
AAACAGCTCCTATCCGCAGAAGATGTGATGCTCGTCTTGGGCAGCACCATTGATAGCACACCTCGGAAAGTCCTTGAAAGTCCTTTTACCTGCAGTTTAGTGGGACTCGGCTTCCTGGGATTCAATGGGATTCAAGTCGCGCCACTGCGAATAGTTCCGGCTATATCCTGGTCACTGGTCACCGTATTTTGCCTATTCAAAAGTCCTGCGGATTGCTTGTGATACTTGTGATACTCGTGGTGGACCCCTTGGATTTCCTGTCCACGATGTGACCAACTGGCGTCATCCTTGGACTGTCGATGTCGACTTTCACCATGTTCTTCATAGACAACCGCGTCAACGTGGTCTAA

Full Affymetrix probeset data:

Annotations for 1637254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720