FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637257_at:

>probe:Drosophila_2:1637257_at:6:93; Interrogation_Position=1945; Antisense; AGTTCCCAGAGGACGAATCTTCGTA
>probe:Drosophila_2:1637257_at:197:103; Interrogation_Position=2072; Antisense; AGAGCTCTATTTGTTTGTGGCCACA
>probe:Drosophila_2:1637257_at:369:595; Interrogation_Position=2087; Antisense; TGTGGCCACATTCCGCGGAACATGT
>probe:Drosophila_2:1637257_at:572:385; Interrogation_Position=2123; Antisense; GAACATCAATGTTGGCCCTGGATCC
>probe:Drosophila_2:1637257_at:134:449; Interrogation_Position=2151; Antisense; GATCCCTGGGAACTGGTTTAGACAT
>probe:Drosophila_2:1637257_at:54:401; Interrogation_Position=2215; Antisense; GACATAGGTCTCGATTAGTCGCTCG
>probe:Drosophila_2:1637257_at:292:705; Interrogation_Position=2229; Antisense; TTAGTCGCTCGATTGGTCCATAGTT
>probe:Drosophila_2:1637257_at:714:139; Interrogation_Position=2311; Antisense; ACGTGTAATCTTTATGCGTGCACTC
>probe:Drosophila_2:1637257_at:577:329; Interrogation_Position=2326; Antisense; GCGTGCACTCTAACCTTTGATTATA
>probe:Drosophila_2:1637257_at:209:461; Interrogation_Position=2344; Antisense; GATTATACTTAATGACGCAGCCGAT
>probe:Drosophila_2:1637257_at:130:411; Interrogation_Position=2357; Antisense; GACGCAGCCGATATTTTGCTATGAT
>probe:Drosophila_2:1637257_at:554:619; Interrogation_Position=2373; Antisense; TGCTATGATATTCCCCTATTTGCAT
>probe:Drosophila_2:1637257_at:384:331; Interrogation_Position=2460; Antisense; GCGGCATGCCAAATCCAATACTTTA
>probe:Drosophila_2:1637257_at:121:235; Interrogation_Position=2485; Antisense; AATGCCATGTATGCCACGATGTTTA

Paste this into a BLAST search page for me
AGTTCCCAGAGGACGAATCTTCGTAAGAGCTCTATTTGTTTGTGGCCACATGTGGCCACATTCCGCGGAACATGTGAACATCAATGTTGGCCCTGGATCCGATCCCTGGGAACTGGTTTAGACATGACATAGGTCTCGATTAGTCGCTCGTTAGTCGCTCGATTGGTCCATAGTTACGTGTAATCTTTATGCGTGCACTCGCGTGCACTCTAACCTTTGATTATAGATTATACTTAATGACGCAGCCGATGACGCAGCCGATATTTTGCTATGATTGCTATGATATTCCCCTATTTGCATGCGGCATGCCAAATCCAATACTTTAAATGCCATGTATGCCACGATGTTTA

Full Affymetrix probeset data:

Annotations for 1637257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720