FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637260_at:

>probe:Drosophila_2:1637260_at:172:135; Interrogation_Position=1079; Antisense; ACGACGAGGACGTTGGACCTTCGCT
>probe:Drosophila_2:1637260_at:65:325; Interrogation_Position=1104; Antisense; GCGACCCGGCGGTAGTCTTAATCAA
>probe:Drosophila_2:1637260_at:38:171; Interrogation_Position=1128; Antisense; AAAGGACTTCGGCAAGGCCTTGCTG
>probe:Drosophila_2:1637260_at:701:619; Interrogation_Position=1148; Antisense; TGCTGCCAGGAGAAGGTGCCGCCAT
>probe:Drosophila_2:1637260_at:196:69; Interrogation_Position=1171; Antisense; ATGGCTGCCTACATTGCCGAGGGCA
>probe:Drosophila_2:1637260_at:113:213; Interrogation_Position=1195; Antisense; AAGAGAATTCCTCGCCGTGGTGAAA
>probe:Drosophila_2:1637260_at:620:235; Interrogation_Position=1239; Antisense; AATCGCCAATTTCGAGTCCGTGGGC
>probe:Drosophila_2:1637260_at:315:609; Interrogation_Position=1271; Antisense; TGAGCGGCAGCAGGCATCGTCGCAT
>probe:Drosophila_2:1637260_at:124:1; Interrogation_Position=1298; Antisense; AGGCCGTCCGTATCCGCAAGGAGAA
>probe:Drosophila_2:1637260_at:677:75; Interrogation_Position=1316; Antisense; AGGAGAACCAGCTGTACTCCGCCGA
>probe:Drosophila_2:1637260_at:314:423; Interrogation_Position=1342; Antisense; GAGAAGCGAGCACTGGCCATGTTCA
>probe:Drosophila_2:1637260_at:570:557; Interrogation_Position=1416; Antisense; GGACATGATCCACTCAAAGCTGCAG
>probe:Drosophila_2:1637260_at:650:397; Interrogation_Position=912; Antisense; GACAGCCGACGGTATCAAGAAGCCT
>probe:Drosophila_2:1637260_at:704:375; Interrogation_Position=942; Antisense; GAAGAAGTCCTCCACTAGCAAAAAG

Paste this into a BLAST search page for me
ACGACGAGGACGTTGGACCTTCGCTGCGACCCGGCGGTAGTCTTAATCAAAAAGGACTTCGGCAAGGCCTTGCTGTGCTGCCAGGAGAAGGTGCCGCCATATGGCTGCCTACATTGCCGAGGGCAAAGAGAATTCCTCGCCGTGGTGAAAAATCGCCAATTTCGAGTCCGTGGGCTGAGCGGCAGCAGGCATCGTCGCATAGGCCGTCCGTATCCGCAAGGAGAAAGGAGAACCAGCTGTACTCCGCCGAGAGAAGCGAGCACTGGCCATGTTCAGGACATGATCCACTCAAAGCTGCAGGACAGCCGACGGTATCAAGAAGCCTGAAGAAGTCCTCCACTAGCAAAAAG

Full Affymetrix probeset data:

Annotations for 1637260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720