FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637261_at:

>probe:Drosophila_2:1637261_at:654:235; Interrogation_Position=391; Antisense; AATCGCCTGATTAACCGGACCCAGA
>probe:Drosophila_2:1637261_at:450:197; Interrogation_Position=415; Antisense; AACGGTGTCCACGAGGAGGTGCATC
>probe:Drosophila_2:1637261_at:563:503; Interrogation_Position=518; Antisense; GTCCAGCTTATCGTCAGGGTTTCGA
>probe:Drosophila_2:1637261_at:144:697; Interrogation_Position=537; Antisense; TTTCGACAATCGAGCCATGGCCATG
>probe:Drosophila_2:1637261_at:588:389; Interrogation_Position=561; Antisense; GAAACAGCAGTATCTCATCCATCAG
>probe:Drosophila_2:1637261_at:534:389; Interrogation_Position=719; Antisense; GAAACACGTATGCAATGCCTCAGAA
>probe:Drosophila_2:1637261_at:40:353; Interrogation_Position=750; Antisense; GCAGCAGAACTACAAGCCGCAGAGT
>probe:Drosophila_2:1637261_at:243:375; Interrogation_Position=793; Antisense; GAAGATCAGCTGCACGCCGAGCAAT
>probe:Drosophila_2:1637261_at:318:367; Interrogation_Position=819; Antisense; GAATCCCTCGCCAATGAAATCAGCT
>probe:Drosophila_2:1637261_at:683:73; Interrogation_Position=869; Antisense; AGGAGTTTGACTCCTTTGGCGGTCA
>probe:Drosophila_2:1637261_at:280:581; Interrogation_Position=885; Antisense; TGGCGGTCAGCTCAACTTCAAATCA
>probe:Drosophila_2:1637261_at:132:165; Interrogation_Position=904; Antisense; AAATCACCCTTCAATGACTACGGCA
>probe:Drosophila_2:1637261_at:12:671; Interrogation_Position=922; Antisense; TACGGCAGTCGACCAGCACGAGATC
>probe:Drosophila_2:1637261_at:53:97; Interrogation_Position=942; Antisense; AGATCTCACCTACCTTCTTTATAAG

Paste this into a BLAST search page for me
AATCGCCTGATTAACCGGACCCAGAAACGGTGTCCACGAGGAGGTGCATCGTCCAGCTTATCGTCAGGGTTTCGATTTCGACAATCGAGCCATGGCCATGGAAACAGCAGTATCTCATCCATCAGGAAACACGTATGCAATGCCTCAGAAGCAGCAGAACTACAAGCCGCAGAGTGAAGATCAGCTGCACGCCGAGCAATGAATCCCTCGCCAATGAAATCAGCTAGGAGTTTGACTCCTTTGGCGGTCATGGCGGTCAGCTCAACTTCAAATCAAAATCACCCTTCAATGACTACGGCATACGGCAGTCGACCAGCACGAGATCAGATCTCACCTACCTTCTTTATAAG

Full Affymetrix probeset data:

Annotations for 1637261_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720