Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637262_at:

>probe:Drosophila_2:1637262_at:480:583; Interrogation_Position=1587; Antisense; TGGCTCCTTCTGATCTGGGCAAATA
>probe:Drosophila_2:1637262_at:566:55; Interrogation_Position=1619; Antisense; ATGAGCATGTCTGTTGTAACCCAAC
>probe:Drosophila_2:1637262_at:561:419; Interrogation_Position=1672; Antisense; GAGCACTCTAGAGCTACTGCTGGAT
>probe:Drosophila_2:1637262_at:686:283; Interrogation_Position=1688; Antisense; CTGCTGGATCGCATTGGAGCCGGAT
>probe:Drosophila_2:1637262_at:277:393; Interrogation_Position=1737; Antisense; GAAAGCTGCGCGTGTTCGGCTGCAT
>probe:Drosophila_2:1637262_at:597:639; Interrogation_Position=1752; Antisense; TCGGCTGCATCGAGCTAACTGTGGA
>probe:Drosophila_2:1637262_at:265:509; Interrogation_Position=1814; Antisense; GTGAATGATGTGTACGCCGATGCCG
>probe:Drosophila_2:1637262_at:321:217; Interrogation_Position=1904; Antisense; AAGTCAGAGGACTCGCGCTTTCGGG
>probe:Drosophila_2:1637262_at:587:655; Interrogation_Position=1935; Antisense; TAATCGAGACGCTACAGGACACCTT
>probe:Drosophila_2:1637262_at:271:663; Interrogation_Position=2034; Antisense; TAAATCTGGAAACCCTGGCCATCAG
>probe:Drosophila_2:1637262_at:238:579; Interrogation_Position=2050; Antisense; GGCCATCAGCTGTGCCGAGGATGAT
>probe:Drosophila_2:1637262_at:272:443; Interrogation_Position=2072; Antisense; GATGTGCTGCGACAAATGCTCAATA
>probe:Drosophila_2:1637262_at:209:463; Interrogation_Position=2102; Antisense; GTTCAGAAGTTACACCAGACCCTAG
>probe:Drosophila_2:1637262_at:596:677; Interrogation_Position=2124; Antisense; TAGTCTCCGCTCTTTGAAAACCATT

Paste this into a BLAST search page for me
TGGCTCCTTCTGATCTGGGCAAATAATGAGCATGTCTGTTGTAACCCAACGAGCACTCTAGAGCTACTGCTGGATCTGCTGGATCGCATTGGAGCCGGATGAAAGCTGCGCGTGTTCGGCTGCATTCGGCTGCATCGAGCTAACTGTGGAGTGAATGATGTGTACGCCGATGCCGAAGTCAGAGGACTCGCGCTTTCGGGTAATCGAGACGCTACAGGACACCTTTAAATCTGGAAACCCTGGCCATCAGGGCCATCAGCTGTGCCGAGGATGATGATGTGCTGCGACAAATGCTCAATAGTTCAGAAGTTACACCAGACCCTAGTAGTCTCCGCTCTTTGAAAACCATT

Full Affymetrix probeset data:

Annotations for 1637262_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime