FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637264_at:

>probe:Drosophila_2:1637264_at:719:717; Interrogation_Position=2169; Antisense; TTCCCACGCGGTTACCAAGCTTGAG
>probe:Drosophila_2:1637264_at:612:207; Interrogation_Position=2185; Antisense; AAGCTTGAGCTCATCGGACGCCATG
>probe:Drosophila_2:1637264_at:82:253; Interrogation_Position=2218; Antisense; CAAGAGATCTCCGTGGGTTCCATAA
>probe:Drosophila_2:1637264_at:340:409; Interrogation_Position=2277; Antisense; GACGAGCACCCGGATGACCGAGACA
>probe:Drosophila_2:1637264_at:324:33; Interrogation_Position=2308; Antisense; ATCAATCGCTCGCTATCGGAGCTCA
>probe:Drosophila_2:1637264_at:308:553; Interrogation_Position=2325; Antisense; GGAGCTCACCAACGTAATCCTGGCG
>probe:Drosophila_2:1637264_at:80:377; Interrogation_Position=2358; Antisense; GAAGCAGGACCACATCCCGTACAGG
>probe:Drosophila_2:1637264_at:513:329; Interrogation_Position=2420; Antisense; GCGGCAACTCGAAAACGCTTATGTT
>probe:Drosophila_2:1637264_at:423:703; Interrogation_Position=2438; Antisense; TTATGTTCATCAACGTCTCGCCGTT
>probe:Drosophila_2:1637264_at:513:317; Interrogation_Position=2457; Antisense; GCCGTTCCAAGACTGTTTCCAAGAG
>probe:Drosophila_2:1637264_at:1:513; Interrogation_Position=2470; Antisense; TGTTTCCAAGAGTCCGTCAAGTCGC
>probe:Drosophila_2:1637264_at:376:315; Interrogation_Position=2506; Antisense; GCCTCCGTAAACTCCTGCAAAATGA
>probe:Drosophila_2:1637264_at:463:365; Interrogation_Position=2544; Antisense; GAATCGCTACCTGAACAACTCGGTG
>probe:Drosophila_2:1637264_at:226:369; Interrogation_Position=2618; Antisense; GAATGCATTCTGAGCCCAGTTTTAA

Paste this into a BLAST search page for me
TTCCCACGCGGTTACCAAGCTTGAGAAGCTTGAGCTCATCGGACGCCATGCAAGAGATCTCCGTGGGTTCCATAAGACGAGCACCCGGATGACCGAGACAATCAATCGCTCGCTATCGGAGCTCAGGAGCTCACCAACGTAATCCTGGCGGAAGCAGGACCACATCCCGTACAGGGCGGCAACTCGAAAACGCTTATGTTTTATGTTCATCAACGTCTCGCCGTTGCCGTTCCAAGACTGTTTCCAAGAGTGTTTCCAAGAGTCCGTCAAGTCGCGCCTCCGTAAACTCCTGCAAAATGAGAATCGCTACCTGAACAACTCGGTGGAATGCATTCTGAGCCCAGTTTTAA

Full Affymetrix probeset data:

Annotations for 1637264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720