FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637265_at:

>probe:Drosophila_2:1637265_at:58:59; Interrogation_Position=355; Antisense; ATGATGTTCGGTCTGCTGCGCTGCA
>probe:Drosophila_2:1637265_at:444:585; Interrogation_Position=398; Antisense; TGGACAGCTTTTCGCACCAGTTAGG
>probe:Drosophila_2:1637265_at:54:381; Interrogation_Position=481; Antisense; GAACCCAAATTGGTCACGCCGGCTA
>probe:Drosophila_2:1637265_at:248:517; Interrogation_Position=510; Antisense; GTGTGCCACATTGACTCCTAGAAAG
>probe:Drosophila_2:1637265_at:245:487; Interrogation_Position=571; Antisense; GTAGCCGCTTTCTTCGACATTCTTA
>probe:Drosophila_2:1637265_at:481:401; Interrogation_Position=586; Antisense; GACATTCTTAGTCCGCCATACGATG
>probe:Drosophila_2:1637265_at:235:23; Interrogation_Position=614; Antisense; ATATGCCAACATATGGACCGCGACA
>probe:Drosophila_2:1637265_at:225:721; Interrogation_Position=714; Antisense; TTGCGATGTTGTGGACACGCCCGAA
>probe:Drosophila_2:1637265_at:528:231; Interrogation_Position=737; Antisense; AATCGGTGATGCAGGCCGCTTTTCA
>probe:Drosophila_2:1637265_at:547:319; Interrogation_Position=766; Antisense; GCCGACGAGGTCTATGCCGATAATG
>probe:Drosophila_2:1637265_at:617:397; Interrogation_Position=798; Antisense; GACACAGTGAGTCGTTATCTCGCTT
>probe:Drosophila_2:1637265_at:617:115; Interrogation_Position=829; Antisense; AGCTAACACCCTCCTATTTATTTGC
>probe:Drosophila_2:1637265_at:685:667; Interrogation_Position=849; Antisense; TTTGCCCATAATCAACCGTTGGCTG
>probe:Drosophila_2:1637265_at:728:481; Interrogation_Position=877; Antisense; GTATCAGCCAAGTATCTTCTGTGTT

Paste this into a BLAST search page for me
ATGATGTTCGGTCTGCTGCGCTGCATGGACAGCTTTTCGCACCAGTTAGGGAACCCAAATTGGTCACGCCGGCTAGTGTGCCACATTGACTCCTAGAAAGGTAGCCGCTTTCTTCGACATTCTTAGACATTCTTAGTCCGCCATACGATGATATGCCAACATATGGACCGCGACATTGCGATGTTGTGGACACGCCCGAAAATCGGTGATGCAGGCCGCTTTTCAGCCGACGAGGTCTATGCCGATAATGGACACAGTGAGTCGTTATCTCGCTTAGCTAACACCCTCCTATTTATTTGCTTTGCCCATAATCAACCGTTGGCTGGTATCAGCCAAGTATCTTCTGTGTT

Full Affymetrix probeset data:

Annotations for 1637265_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720