FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637267_at:

>probe:Drosophila_2:1637267_at:230:221; Interrogation_Position=1018; Antisense; AAGTGGGTTCTCCAAGTCAGGCTAC
>probe:Drosophila_2:1637267_at:686:67; Interrogation_Position=1053; Antisense; AGGCCAGTCTGCGAAACTACCGGTT
>probe:Drosophila_2:1637267_at:184:379; Interrogation_Position=1132; Antisense; GAAGCCCCAGCCGAGTGATATAGTC
>probe:Drosophila_2:1637267_at:700:485; Interrogation_Position=1214; Antisense; GTAGCTCATCCGGAACATGGTCTTA
>probe:Drosophila_2:1637267_at:420:269; Interrogation_Position=1229; Antisense; CATGGTCTTATGTTTGCTCACAAGG
>probe:Drosophila_2:1637267_at:556:385; Interrogation_Position=1264; Antisense; GAACATACCCGTTACCACCAAGAAG
>probe:Drosophila_2:1637267_at:454:693; Interrogation_Position=1296; Antisense; TTTCCAGCAACGTTAGACGCTCTAT
>probe:Drosophila_2:1637267_at:601:711; Interrogation_Position=1343; Antisense; TTCATTATACTGTACGACCACCACG
>probe:Drosophila_2:1637267_at:189:15; Interrogation_Position=785; Antisense; ATTACTCTCACAAAACTCGGCTATC
>probe:Drosophila_2:1637267_at:689:635; Interrogation_Position=808; Antisense; TCGGGAACACCGCACTTTCTACGAG
>probe:Drosophila_2:1637267_at:674:385; Interrogation_Position=866; Antisense; GAACAGCTCCTGAATCCAACGGTTT
>probe:Drosophila_2:1637267_at:282:235; Interrogation_Position=878; Antisense; AATCCAACGGTTTCTGCCCAGATAT
>probe:Drosophila_2:1637267_at:505:199; Interrogation_Position=925; Antisense; AACCGATCCAGCACTTTGGGCATTG
>probe:Drosophila_2:1637267_at:584:457; Interrogation_Position=982; Antisense; GATATCGACCATTATCTTTCTGGAA

Paste this into a BLAST search page for me
AAGTGGGTTCTCCAAGTCAGGCTACAGGCCAGTCTGCGAAACTACCGGTTGAAGCCCCAGCCGAGTGATATAGTCGTAGCTCATCCGGAACATGGTCTTACATGGTCTTATGTTTGCTCACAAGGGAACATACCCGTTACCACCAAGAAGTTTCCAGCAACGTTAGACGCTCTATTTCATTATACTGTACGACCACCACGATTACTCTCACAAAACTCGGCTATCTCGGGAACACCGCACTTTCTACGAGGAACAGCTCCTGAATCCAACGGTTTAATCCAACGGTTTCTGCCCAGATATAACCGATCCAGCACTTTGGGCATTGGATATCGACCATTATCTTTCTGGAA

Full Affymetrix probeset data:

Annotations for 1637267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720