Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637269_at:

>probe:Drosophila_2:1637269_at:138:435; Interrogation_Position=133; Antisense; GAGGGCATTATCAAGCAGAGTCAAC
>probe:Drosophila_2:1637269_at:311:619; Interrogation_Position=203; Antisense; TGCTCAATCCCACCATTTTAAACTT
>probe:Drosophila_2:1637269_at:168:215; Interrogation_Position=229; Antisense; AAGATCCTAGCTGATCATGGCCACG
>probe:Drosophila_2:1637269_at:377:137; Interrogation_Position=257; Antisense; ACGACTGGCGTTACACGGTGCAGTA
>probe:Drosophila_2:1637269_at:223:491; Interrogation_Position=279; Antisense; GTACACAGAGCGACTATCCCATTGG
>probe:Drosophila_2:1637269_at:727:269; Interrogation_Position=305; Antisense; CATACTGGCTGAATACGGCTACGGC
>probe:Drosophila_2:1637269_at:200:493; Interrogation_Position=340; Antisense; GTCACCAAGTCATTACCCGGAGTAT
>probe:Drosophila_2:1637269_at:327:581; Interrogation_Position=371; Antisense; TGGCCTATGCCATTAAGTCCACGCA
>probe:Drosophila_2:1637269_at:399:35; Interrogation_Position=395; Antisense; ATCAGACTTGCTTCTTTGCCGGATT
>probe:Drosophila_2:1637269_at:501:693; Interrogation_Position=409; Antisense; TTTGCCGGATTCTATTGCCTACAAT
>probe:Drosophila_2:1637269_at:658:229; Interrogation_Position=463; Antisense; AATGGTGATACCTTTGCCCAGGAGA
>probe:Drosophila_2:1637269_at:472:107; Interrogation_Position=485; Antisense; AGAACATCCAGTATCAGTGTCCACC
>probe:Drosophila_2:1637269_at:665:321; Interrogation_Position=549; Antisense; GCGCCAGGCGGTGATGCACAACTTA
>probe:Drosophila_2:1637269_at:88:61; Interrogation_Position=92; Antisense; ATGTCTTCGTTTTCTCCAGTGGCTA

Paste this into a BLAST search page for me
GAGGGCATTATCAAGCAGAGTCAACTGCTCAATCCCACCATTTTAAACTTAAGATCCTAGCTGATCATGGCCACGACGACTGGCGTTACACGGTGCAGTAGTACACAGAGCGACTATCCCATTGGCATACTGGCTGAATACGGCTACGGCGTCACCAAGTCATTACCCGGAGTATTGGCCTATGCCATTAAGTCCACGCAATCAGACTTGCTTCTTTGCCGGATTTTTGCCGGATTCTATTGCCTACAATAATGGTGATACCTTTGCCCAGGAGAAGAACATCCAGTATCAGTGTCCACCGCGCCAGGCGGTGATGCACAACTTAATGTCTTCGTTTTCTCCAGTGGCTA

Full Affymetrix probeset data:

Annotations for 1637269_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime