FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637270_at:

>probe:Drosophila_2:1637270_at:82:107; Interrogation_Position=1037; Antisense; AGAACCTGACGGGACTGTACCTCGA
>probe:Drosophila_2:1637270_at:388:671; Interrogation_Position=1066; Antisense; TACCGGCTGAACTGCACCAACGAGA
>probe:Drosophila_2:1637270_at:207:519; Interrogation_Position=1126; Antisense; GTGGTGGACCACAACTACTGGGCGC
>probe:Drosophila_2:1637270_at:463:669; Interrogation_Position=1141; Antisense; TACTGGGCGCTCATCCTGATTCTGT
>probe:Drosophila_2:1637270_at:244:633; Interrogation_Position=1225; Antisense; TCCCTGCAGACGGTCACGAATTATT
>probe:Drosophila_2:1637270_at:427:17; Interrogation_Position=1247; Antisense; ATTTTATAGTCTCGTTGGCCATCGC
>probe:Drosophila_2:1637270_at:712:531; Interrogation_Position=1290; Antisense; GGTCGTGATGCCATTTGCTGTCTAC
>probe:Drosophila_2:1637270_at:682:19; Interrogation_Position=1302; Antisense; ATTTGCTGTCTACTTTCTGGAGCCA
>probe:Drosophila_2:1637270_at:147:697; Interrogation_Position=1315; Antisense; TTTCTGGAGCCAGTGGAGCCCACAA
>probe:Drosophila_2:1637270_at:315:129; Interrogation_Position=802; Antisense; ACCAGTTACGATGGAGGCGGCTCTG
>probe:Drosophila_2:1637270_at:349:269; Interrogation_Position=909; Antisense; CATGCTGCTGCTCGAAAACTTTAAC
>probe:Drosophila_2:1637270_at:107:197; Interrogation_Position=931; Antisense; AACGATTATTTTCCCAACTACAATG
>probe:Drosophila_2:1637270_at:464:145; Interrogation_Position=947; Antisense; ACTACAATGGGAGCACGGTTTCGGG
>probe:Drosophila_2:1637270_at:463:387; Interrogation_Position=971; Antisense; GAACAAGCACCATTGCGCCGGGAGT

Paste this into a BLAST search page for me
AGAACCTGACGGGACTGTACCTCGATACCGGCTGAACTGCACCAACGAGAGTGGTGGACCACAACTACTGGGCGCTACTGGGCGCTCATCCTGATTCTGTTCCCTGCAGACGGTCACGAATTATTATTTTATAGTCTCGTTGGCCATCGCGGTCGTGATGCCATTTGCTGTCTACATTTGCTGTCTACTTTCTGGAGCCATTTCTGGAGCCAGTGGAGCCCACAAACCAGTTACGATGGAGGCGGCTCTGCATGCTGCTGCTCGAAAACTTTAACAACGATTATTTTCCCAACTACAATGACTACAATGGGAGCACGGTTTCGGGGAACAAGCACCATTGCGCCGGGAGT

Full Affymetrix probeset data:

Annotations for 1637270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720