Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637272_at:

>probe:Drosophila_2:1637272_at:630:75; Interrogation_Position=104; Antisense; AGGACCACATCCACTATTGCTGCAA
>probe:Drosophila_2:1637272_at:159:691; Interrogation_Position=118; Antisense; TATTGCTGCAAGCATCCCGATGGAC
>probe:Drosophila_2:1637272_at:643:551; Interrogation_Position=171; Antisense; GGAGACCAATTTTACGCTGCCCAAT
>probe:Drosophila_2:1637272_at:707:325; Interrogation_Position=263; Antisense; GCGTCTTTAGCAAACTGAACCTGAT
>probe:Drosophila_2:1637272_at:661:185; Interrogation_Position=295; Antisense; AACAACCTGGACATGGATGCCGTGA
>probe:Drosophila_2:1637272_at:553:1; Interrogation_Position=337; Antisense; AGGTTTCCCGACGATCCGGAATATG
>probe:Drosophila_2:1637272_at:107:135; Interrogation_Position=377; Antisense; ACGCCTTTGATCATTGTCACGGCAA
>probe:Drosophila_2:1637272_at:697:635; Interrogation_Position=430; Antisense; TCGAAGCCCCTCTTCAAGCAAATGT
>probe:Drosophila_2:1637272_at:406:317; Interrogation_Position=44; Antisense; GCCTGATTTGGTTTGCTGGTGGAAT
>probe:Drosophila_2:1637272_at:426:361; Interrogation_Position=459; Antisense; GCAATTCTGCGATCCGAAGTCTAGT
>probe:Drosophila_2:1637272_at:642:373; Interrogation_Position=474; Antisense; GAAGTCTAGTGTCGTCCTGGCCTGT
>probe:Drosophila_2:1637272_at:657:287; Interrogation_Position=527; Antisense; CGGCGGATCGCTGGTCGAAGACCAA
>probe:Drosophila_2:1637272_at:364:75; Interrogation_Position=551; Antisense; AGGAGTGCGAGGATACCCTGGCCTT
>probe:Drosophila_2:1637272_at:578:663; Interrogation_Position=87; Antisense; TACGGAGGCCATTAACGAGGACCAC

Paste this into a BLAST search page for me
AGGACCACATCCACTATTGCTGCAATATTGCTGCAAGCATCCCGATGGACGGAGACCAATTTTACGCTGCCCAATGCGTCTTTAGCAAACTGAACCTGATAACAACCTGGACATGGATGCCGTGAAGGTTTCCCGACGATCCGGAATATGACGCCTTTGATCATTGTCACGGCAATCGAAGCCCCTCTTCAAGCAAATGTGCCTGATTTGGTTTGCTGGTGGAATGCAATTCTGCGATCCGAAGTCTAGTGAAGTCTAGTGTCGTCCTGGCCTGTCGGCGGATCGCTGGTCGAAGACCAAAGGAGTGCGAGGATACCCTGGCCTTTACGGAGGCCATTAACGAGGACCAC

Full Affymetrix probeset data:

Annotations for 1637272_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime