FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637274_at:

>probe:Drosophila_2:1637274_at:458:365; Interrogation_Position=107; Antisense; GAATCTCAAGCGAGTTTTGCTCCAC
>probe:Drosophila_2:1637274_at:649:393; Interrogation_Position=142; Antisense; GAAAGTGCTCCCCACTAGAGCAAAT
>probe:Drosophila_2:1637274_at:564:421; Interrogation_Position=159; Antisense; GAGCAAATCGCATGGAACAGTTTCT
>probe:Drosophila_2:1637274_at:508:385; Interrogation_Position=173; Antisense; GAACAGTTTCTATGGCAGGAACTCT
>probe:Drosophila_2:1637274_at:608:381; Interrogation_Position=191; Antisense; GAACTCTTTGCCGAATACAACCGAC
>probe:Drosophila_2:1637274_at:125:437; Interrogation_Position=242; Antisense; GAGGATCGCACGGAGTACTACGACC
>probe:Drosophila_2:1637274_at:573:489; Interrogation_Position=256; Antisense; GTACTACGACCAGTTCTGCAAGGAT
>probe:Drosophila_2:1637274_at:715:471; Interrogation_Position=268; Antisense; GTTCTGCAAGGATGTGCCACCGAAA
>probe:Drosophila_2:1637274_at:571:373; Interrogation_Position=308; Antisense; GAAGTTCTGGTCAACAAGTATCCAC
>probe:Drosophila_2:1637274_at:127:91; Interrogation_Position=324; Antisense; AGTATCCACTTTACTGCACTACTGC
>probe:Drosophila_2:1637274_at:75:435; Interrogation_Position=368; Antisense; GAGGGAGATTTCACCAAGACTTTCA
>probe:Drosophila_2:1637274_at:453:103; Interrogation_Position=413; Antisense; AGACCTATAGATCTGTGTCCTGATA
>probe:Drosophila_2:1637274_at:70:653; Interrogation_Position=64; Antisense; TAATTTGGTACTCCCAGTGGGCCCA
>probe:Drosophila_2:1637274_at:427:253; Interrogation_Position=78; Antisense; CAGTGGGCCCATGTTCAACGGAACT

Paste this into a BLAST search page for me
GAATCTCAAGCGAGTTTTGCTCCACGAAAGTGCTCCCCACTAGAGCAAATGAGCAAATCGCATGGAACAGTTTCTGAACAGTTTCTATGGCAGGAACTCTGAACTCTTTGCCGAATACAACCGACGAGGATCGCACGGAGTACTACGACCGTACTACGACCAGTTCTGCAAGGATGTTCTGCAAGGATGTGCCACCGAAAGAAGTTCTGGTCAACAAGTATCCACAGTATCCACTTTACTGCACTACTGCGAGGGAGATTTCACCAAGACTTTCAAGACCTATAGATCTGTGTCCTGATATAATTTGGTACTCCCAGTGGGCCCACAGTGGGCCCATGTTCAACGGAACT

Full Affymetrix probeset data:

Annotations for 1637274_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720