Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637276_at:

>probe:Drosophila_2:1637276_at:301:339; Interrogation_Position=2020; Antisense; GCTCACACACTATGCCATTGTCAAA
>probe:Drosophila_2:1637276_at:352:255; Interrogation_Position=2041; Antisense; CAAACATACGCATACTCATCATCAC
>probe:Drosophila_2:1637276_at:26:261; Interrogation_Position=2060; Antisense; CATCACATCTTACAAACATTCCCAA
>probe:Drosophila_2:1637276_at:544:389; Interrogation_Position=2105; Antisense; GAAACACAGGCGAATGCATTAGCTT
>probe:Drosophila_2:1637276_at:663:529; Interrogation_Position=2147; Antisense; GGGTTGGCAAAATCCACTCGCATGA
>probe:Drosophila_2:1637276_at:610:613; Interrogation_Position=2169; Antisense; TGAATCCCCATTTAACATACCCGTA
>probe:Drosophila_2:1637276_at:24:481; Interrogation_Position=2191; Antisense; GTATTCCTCGCGTTAGACTAGACTT
>probe:Drosophila_2:1637276_at:707:403; Interrogation_Position=2206; Antisense; GACTAGACTTCACAGATTGCAGCAT
>probe:Drosophila_2:1637276_at:688:115; Interrogation_Position=2226; Antisense; AGCATGGATCTTTCTGGCAGTGTTC
>probe:Drosophila_2:1637276_at:335:349; Interrogation_Position=2242; Antisense; GCAGTGTTCCTCGTTCACGATGCAA
>probe:Drosophila_2:1637276_at:159:483; Interrogation_Position=2307; Antisense; GTATTTCCAGAATCCGTCTGTACAG
>probe:Drosophila_2:1637276_at:716:525; Interrogation_Position=2333; Antisense; GGGCACCTTATGTTTGCGTGTACTA
>probe:Drosophila_2:1637276_at:344:329; Interrogation_Position=2348; Antisense; GCGTGTACTAGGCTTTTTATTGGAT
>probe:Drosophila_2:1637276_at:516:455; Interrogation_Position=2370; Antisense; GATACGTTTCGAGCTCATTTCGGAT

Paste this into a BLAST search page for me
GCTCACACACTATGCCATTGTCAAACAAACATACGCATACTCATCATCACCATCACATCTTACAAACATTCCCAAGAAACACAGGCGAATGCATTAGCTTGGGTTGGCAAAATCCACTCGCATGATGAATCCCCATTTAACATACCCGTAGTATTCCTCGCGTTAGACTAGACTTGACTAGACTTCACAGATTGCAGCATAGCATGGATCTTTCTGGCAGTGTTCGCAGTGTTCCTCGTTCACGATGCAAGTATTTCCAGAATCCGTCTGTACAGGGGCACCTTATGTTTGCGTGTACTAGCGTGTACTAGGCTTTTTATTGGATGATACGTTTCGAGCTCATTTCGGAT

Full Affymetrix probeset data:

Annotations for 1637276_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime