FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637277_at:

>probe:Drosophila_2:1637277_at:639:679; Interrogation_Position=1081; Antisense; TATCGTCGGACAGCCGGCAGGATAA
>probe:Drosophila_2:1637277_at:200:117; Interrogation_Position=1108; Antisense; AGCTTGATTCGCATGATCCTCCAAA
>probe:Drosophila_2:1637277_at:381:567; Interrogation_Position=1168; Antisense; GGCACTGGCCTGGAACTTTTATGGA
>probe:Drosophila_2:1637277_at:233:29; Interrogation_Position=1237; Antisense; ATAACTATGTTACCCTCTGTACCAA
>probe:Drosophila_2:1637277_at:385:665; Interrogation_Position=1275; Antisense; TACAAAAGCCTTTCCGTTGTGTCCT
>probe:Drosophila_2:1637277_at:421:535; Interrogation_Position=1343; Antisense; GGTGCTCAACCGAATGATCTGCGAT
>probe:Drosophila_2:1637277_at:439:603; Interrogation_Position=1357; Antisense; TGATCTGCGATTCGGCGTACGGCAA
>probe:Drosophila_2:1637277_at:461:489; Interrogation_Position=1373; Antisense; GTACGGCAATTTTCTTCTGCGCGAA
>probe:Drosophila_2:1637277_at:296:351; Interrogation_Position=1431; Antisense; GCAGACTGTATGTTTAGCGCCGGAT
>probe:Drosophila_2:1637277_at:56:549; Interrogation_Position=1452; Antisense; GGATGTCCTGTGACTGCTGGAGATC
>probe:Drosophila_2:1637277_at:5:97; Interrogation_Position=1472; Antisense; AGATCAGCTTTGTGGTATCGTCGCC
>probe:Drosophila_2:1637277_at:493:633; Interrogation_Position=1502; Antisense; TCCCGCCTGCAAGAGATCCAATTTA
>probe:Drosophila_2:1637277_at:330:697; Interrogation_Position=1523; Antisense; TTTACCAGGGATCTTCACCGATATC
>probe:Drosophila_2:1637277_at:356:145; Interrogation_Position=1648; Antisense; ACTCGGGTCTCTGGCTAAGTCGTTA

Paste this into a BLAST search page for me
TATCGTCGGACAGCCGGCAGGATAAAGCTTGATTCGCATGATCCTCCAAAGGCACTGGCCTGGAACTTTTATGGAATAACTATGTTACCCTCTGTACCAATACAAAAGCCTTTCCGTTGTGTCCTGGTGCTCAACCGAATGATCTGCGATTGATCTGCGATTCGGCGTACGGCAAGTACGGCAATTTTCTTCTGCGCGAAGCAGACTGTATGTTTAGCGCCGGATGGATGTCCTGTGACTGCTGGAGATCAGATCAGCTTTGTGGTATCGTCGCCTCCCGCCTGCAAGAGATCCAATTTATTTACCAGGGATCTTCACCGATATCACTCGGGTCTCTGGCTAAGTCGTTA

Full Affymetrix probeset data:

Annotations for 1637277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720