FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637278_at:

>probe:Drosophila_2:1637278_at:78:551; Interrogation_Position=1149; Antisense; GGAGCAACAGTGGTTCCACCAAGCC
>probe:Drosophila_2:1637278_at:485:257; Interrogation_Position=1165; Antisense; CACCAAGCCCCGGATGAAGCGAAAG
>probe:Drosophila_2:1637278_at:392:205; Interrogation_Position=1181; Antisense; AAGCGAAAGCCTCGCGTGCTCTTTT
>probe:Drosophila_2:1637278_at:117:333; Interrogation_Position=1225; Antisense; GCTGGAGTGTCGCTTTCGACTCAAA
>probe:Drosophila_2:1637278_at:94:45; Interrogation_Position=1280; Antisense; ATCGCGCAAAAGCTTAACCTGTCGG
>probe:Drosophila_2:1637278_at:149:285; Interrogation_Position=1298; Antisense; CTGTCGGCCACCCAAGTGAAGATTT
>probe:Drosophila_2:1637278_at:382:367; Interrogation_Position=1330; Antisense; GAATCGGCGCTACAAATCGAAACGT
>probe:Drosophila_2:1637278_at:698:175; Interrogation_Position=1349; Antisense; AAACGTGGCGACATCGACTGCGAGG
>probe:Drosophila_2:1637278_at:121:83; Interrogation_Position=1371; Antisense; AGGGCATCGCCAAGCATCTGAAGTT
>probe:Drosophila_2:1637278_at:114:41; Interrogation_Position=1386; Antisense; ATCTGAAGTTGAAGTCCGAGCCCCT
>probe:Drosophila_2:1637278_at:197:319; Interrogation_Position=1435; Antisense; GCCGATTCCCAACCACGTGATGTGG
>probe:Drosophila_2:1637278_at:510:601; Interrogation_Position=1527; Antisense; TGTAGTGGACATCTCGCAGGACGAA
>probe:Drosophila_2:1637278_at:507:463; Interrogation_Position=1553; Antisense; GATTCGAGTCTCTAATTTATTGCAG
>probe:Drosophila_2:1637278_at:659:199; Interrogation_Position=1611; Antisense; AACGCCTCATAGTTCTAGTTCTTTG

Paste this into a BLAST search page for me
GGAGCAACAGTGGTTCCACCAAGCCCACCAAGCCCCGGATGAAGCGAAAGAAGCGAAAGCCTCGCGTGCTCTTTTGCTGGAGTGTCGCTTTCGACTCAAAATCGCGCAAAAGCTTAACCTGTCGGCTGTCGGCCACCCAAGTGAAGATTTGAATCGGCGCTACAAATCGAAACGTAAACGTGGCGACATCGACTGCGAGGAGGGCATCGCCAAGCATCTGAAGTTATCTGAAGTTGAAGTCCGAGCCCCTGCCGATTCCCAACCACGTGATGTGGTGTAGTGGACATCTCGCAGGACGAAGATTCGAGTCTCTAATTTATTGCAGAACGCCTCATAGTTCTAGTTCTTTG

Full Affymetrix probeset data:

Annotations for 1637278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720