FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637279_at:

>probe:Drosophila_2:1637279_at:715:723; Interrogation_Position=225; Antisense; TTGCACCAATGGTCGACCTGCGGAT
>probe:Drosophila_2:1637279_at:186:623; Interrogation_Position=243; Antisense; TGCGGATACCCTATCAATTCAGTTT
>probe:Drosophila_2:1637279_at:380:247; Interrogation_Position=276; Antisense; CAATATTAGTGCCATGGGTCCGAAT
>probe:Drosophila_2:1637279_at:525:111; Interrogation_Position=326; Antisense; AGCACGAAGACTTTGATCCCACTCG
>probe:Drosophila_2:1637279_at:253:449; Interrogation_Position=340; Antisense; GATCCCACTCGCCAAAATGCAAATG
>probe:Drosophila_2:1637279_at:82:55; Interrogation_Position=356; Antisense; ATGCAAATGACATCTCGCTGCTGAT
>probe:Drosophila_2:1637279_at:140:203; Interrogation_Position=389; Antisense; AACCTTTTGAGTTCGATGGCGTCTC
>probe:Drosophila_2:1637279_at:124:623; Interrogation_Position=447; Antisense; TGCTGTGCCTCAATCGGATGCTGGA
>probe:Drosophila_2:1637279_at:422:509; Interrogation_Position=520; Antisense; GTGCAGGACACCCTACAGGAGGTTT
>probe:Drosophila_2:1637279_at:602:435; Interrogation_Position=538; Antisense; GAGGTTTCCCTGAAGATTTACTCGG
>probe:Drosophila_2:1637279_at:288:615; Interrogation_Position=564; Antisense; TGAAGAGTGCACCAGCCGGCACAAT
>probe:Drosophila_2:1637279_at:712:565; Interrogation_Position=581; Antisense; GGCACAATGGCCAAACGGATCCCAA
>probe:Drosophila_2:1637279_at:129:547; Interrogation_Position=597; Antisense; GGATCCCAAATATCACATATGCGGA
>probe:Drosophila_2:1637279_at:669:43; Interrogation_Position=740; Antisense; ATCCGGGTGTCTACTGTAAGGTTAG

Paste this into a BLAST search page for me
TTGCACCAATGGTCGACCTGCGGATTGCGGATACCCTATCAATTCAGTTTCAATATTAGTGCCATGGGTCCGAATAGCACGAAGACTTTGATCCCACTCGGATCCCACTCGCCAAAATGCAAATGATGCAAATGACATCTCGCTGCTGATAACCTTTTGAGTTCGATGGCGTCTCTGCTGTGCCTCAATCGGATGCTGGAGTGCAGGACACCCTACAGGAGGTTTGAGGTTTCCCTGAAGATTTACTCGGTGAAGAGTGCACCAGCCGGCACAATGGCACAATGGCCAAACGGATCCCAAGGATCCCAAATATCACATATGCGGAATCCGGGTGTCTACTGTAAGGTTAG

Full Affymetrix probeset data:

Annotations for 1637279_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720