Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637280_at:

>probe:Drosophila_2:1637280_at:482:727; Interrogation_Position=2941; Antisense; TTGGATGATTGTTGCGCTTGGTCGC
>probe:Drosophila_2:1637280_at:324:319; Interrogation_Position=2954; Antisense; GCGCTTGGTCGCTGGGAAAATTAGA
>probe:Drosophila_2:1637280_at:21:445; Interrogation_Position=2977; Antisense; GATGACCAATGCTAACTCGAGACCC
>probe:Drosophila_2:1637280_at:322:339; Interrogation_Position=2987; Antisense; GCTAACTCGAGACCCGCGGCAGAAA
>probe:Drosophila_2:1637280_at:676:329; Interrogation_Position=3002; Antisense; GCGGCAGAAACACACACGCCTGAAG
>probe:Drosophila_2:1637280_at:267:135; Interrogation_Position=3017; Antisense; ACGCCTGAAGACTGAGCAACTCTGT
>probe:Drosophila_2:1637280_at:690:421; Interrogation_Position=3030; Antisense; GAGCAACTCTGTGTATTGTGTAAAT
>probe:Drosophila_2:1637280_at:718:535; Interrogation_Position=3093; Antisense; GGTCACCTTGGAGCGCATCCTTAAA
>probe:Drosophila_2:1637280_at:338:669; Interrogation_Position=3133; Antisense; TACTATGTCGCAGAGTTCTATCACA
>probe:Drosophila_2:1637280_at:653:425; Interrogation_Position=3324; Antisense; GAGATCATTGTGCTTATGGTCTACT
>probe:Drosophila_2:1637280_at:681:243; Interrogation_Position=3366; Antisense; AATTATATTTCTGTTGTCAAGGAGC
>probe:Drosophila_2:1637280_at:304:553; Interrogation_Position=3386; Antisense; GGAGCAGAGTCGTTTTATTATATTA
>probe:Drosophila_2:1637280_at:58:145; Interrogation_Position=3419; Antisense; ACTGCATACGTATTAGCCTTTTGTT
>probe:Drosophila_2:1637280_at:448:57; Interrogation_Position=3471; Antisense; ATGTATATGTTTCCCCACTAAAAAG

Paste this into a BLAST search page for me
TTGGATGATTGTTGCGCTTGGTCGCGCGCTTGGTCGCTGGGAAAATTAGAGATGACCAATGCTAACTCGAGACCCGCTAACTCGAGACCCGCGGCAGAAAGCGGCAGAAACACACACGCCTGAAGACGCCTGAAGACTGAGCAACTCTGTGAGCAACTCTGTGTATTGTGTAAATGGTCACCTTGGAGCGCATCCTTAAATACTATGTCGCAGAGTTCTATCACAGAGATCATTGTGCTTATGGTCTACTAATTATATTTCTGTTGTCAAGGAGCGGAGCAGAGTCGTTTTATTATATTAACTGCATACGTATTAGCCTTTTGTTATGTATATGTTTCCCCACTAAAAAG

Full Affymetrix probeset data:

Annotations for 1637280_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime