FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637281_at:

>probe:Drosophila_2:1637281_at:536:283; Interrogation_Position=116; Antisense; CTGCTGACAAAGAATTTCGCCATAG
>probe:Drosophila_2:1637281_at:518:397; Interrogation_Position=121; Antisense; GACAAAGAATTTCGCCATAGCAATA
>probe:Drosophila_2:1637281_at:376:19; Interrogation_Position=129; Antisense; ATTTCGCCATAGCAATAGGCGCCGA
>probe:Drosophila_2:1637281_at:720:313; Interrogation_Position=134; Antisense; GCCATAGCAATAGGCGCCGAAGTCG
>probe:Drosophila_2:1637281_at:112:243; Interrogation_Position=142; Antisense; AATAGGCGCCGAAGTCGCCACATTG
>probe:Drosophila_2:1637281_at:447:317; Interrogation_Position=149; Antisense; GCCGAAGTCGCCACATTGCTACATG
>probe:Drosophila_2:1637281_at:472:373; Interrogation_Position=152; Antisense; GAAGTCGCCACATTGCTACATGTGA
>probe:Drosophila_2:1637281_at:212:503; Interrogation_Position=155; Antisense; GTCGCCACATTGCTACATGTGAAGT
>probe:Drosophila_2:1637281_at:72:273; Interrogation_Position=162; Antisense; CATTGCTACATGTGAAGTGCCAAAT
>probe:Drosophila_2:1637281_at:516:339; Interrogation_Position=166; Antisense; GCTACATGTGAAGTGCCAAATGCCA
>probe:Drosophila_2:1637281_at:148:269; Interrogation_Position=170; Antisense; CATGTGAAGTGCCAAATGCCAGGAT
>probe:Drosophila_2:1637281_at:155:511; Interrogation_Position=173; Antisense; GTGAAGTGCCAAATGCCAGGATAAT
>probe:Drosophila_2:1637281_at:335:167; Interrogation_Position=183; Antisense; AAATGCCAGGATAATGGGCTACTCC
>probe:Drosophila_2:1637281_at:509:625; Interrogation_Position=186; Antisense; TGCCAGGATAATGGGCTACTCCTAA

Paste this into a BLAST search page for me
CTGCTGACAAAGAATTTCGCCATAGGACAAAGAATTTCGCCATAGCAATAATTTCGCCATAGCAATAGGCGCCGAGCCATAGCAATAGGCGCCGAAGTCGAATAGGCGCCGAAGTCGCCACATTGGCCGAAGTCGCCACATTGCTACATGGAAGTCGCCACATTGCTACATGTGAGTCGCCACATTGCTACATGTGAAGTCATTGCTACATGTGAAGTGCCAAATGCTACATGTGAAGTGCCAAATGCCACATGTGAAGTGCCAAATGCCAGGATGTGAAGTGCCAAATGCCAGGATAATAAATGCCAGGATAATGGGCTACTCCTGCCAGGATAATGGGCTACTCCTAA

Full Affymetrix probeset data:

Annotations for 1637281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720