FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637282_at:

>probe:Drosophila_2:1637282_at:386:209; Interrogation_Position=391; Antisense; AAGCACTACTCCTGCGATCAAGATT
>probe:Drosophila_2:1637282_at:250:559; Interrogation_Position=430; Antisense; GGACAATGGAAACTCACCTGCAGCT
>probe:Drosophila_2:1637282_at:416:241; Interrogation_Position=479; Antisense; AATAGCAATGCACAGGACGCCGCCG
>probe:Drosophila_2:1637282_at:532:431; Interrogation_Position=506; Antisense; GAGTCTACCGTATCTTCAAGCAGTA
>probe:Drosophila_2:1637282_at:402:689; Interrogation_Position=529; Antisense; TATTAGGACTTCTTGTCGCTTCGGC
>probe:Drosophila_2:1637282_at:278:395; Interrogation_Position=570; Antisense; GAAATCCAGCTCATCGTAGTGCAGA
>probe:Drosophila_2:1637282_at:482:529; Interrogation_Position=606; Antisense; GGGATCAGGATTACCGGCGACCAAA
>probe:Drosophila_2:1637282_at:707:725; Interrogation_Position=661; Antisense; TTGTCCTTTCGGTAACGCATGCTAT
>probe:Drosophila_2:1637282_at:99:491; Interrogation_Position=690; Antisense; GTAACCCAGTTCACTTCCAGGATTA
>probe:Drosophila_2:1637282_at:46:15; Interrogation_Position=711; Antisense; ATTACTCCCATCCTGCGGATTGTAA
>probe:Drosophila_2:1637282_at:341:227; Interrogation_Position=740; Antisense; AAGGCTTGGCATACTTCGGCTTCAA
>probe:Drosophila_2:1637282_at:120:275; Interrogation_Position=778; Antisense; CATTGTAGTCAATTCCGCGCAGAAC
>probe:Drosophila_2:1637282_at:414:385; Interrogation_Position=799; Antisense; GAACATTCGAAATCGTCTGCGTCAA
>probe:Drosophila_2:1637282_at:175:547; Interrogation_Position=871; Antisense; GGATGAACCCTTTGGTGGCGACAAT

Paste this into a BLAST search page for me
AAGCACTACTCCTGCGATCAAGATTGGACAATGGAAACTCACCTGCAGCTAATAGCAATGCACAGGACGCCGCCGGAGTCTACCGTATCTTCAAGCAGTATATTAGGACTTCTTGTCGCTTCGGCGAAATCCAGCTCATCGTAGTGCAGAGGGATCAGGATTACCGGCGACCAAATTGTCCTTTCGGTAACGCATGCTATGTAACCCAGTTCACTTCCAGGATTAATTACTCCCATCCTGCGGATTGTAAAAGGCTTGGCATACTTCGGCTTCAACATTGTAGTCAATTCCGCGCAGAACGAACATTCGAAATCGTCTGCGTCAAGGATGAACCCTTTGGTGGCGACAAT

Full Affymetrix probeset data:

Annotations for 1637282_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720