Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637284_at:

>probe:Drosophila_2:1637284_at:719:379; Interrogation_Position=1911; Antisense; GAACGACGGGCCTGTATTGCTCTAC
>probe:Drosophila_2:1637284_at:646:643; Interrogation_Position=1931; Antisense; TCTACAAGTTGAGCTGCGGCTCCAG
>probe:Drosophila_2:1637284_at:536:331; Interrogation_Position=1946; Antisense; GCGGCTCCAGCAGTTTTAATGTATT
>probe:Drosophila_2:1637284_at:74:457; Interrogation_Position=2010; Antisense; GATATAACTAAGTTCCTATTCCGGA
>probe:Drosophila_2:1637284_at:555:687; Interrogation_Position=2026; Antisense; TATTCCGGAAACTTAATGGTCACAT
>probe:Drosophila_2:1637284_at:140:17; Interrogation_Position=2175; Antisense; ATTTATCTGCAAACGTAGTCACTGT
>probe:Drosophila_2:1637284_at:402:179; Interrogation_Position=2203; Antisense; AAACAGTGTCCTTTGTGAATTGCAA
>probe:Drosophila_2:1637284_at:713:419; Interrogation_Position=2233; Antisense; GAGAATTTTCAGTTCAGCTTTTAAG
>probe:Drosophila_2:1637284_at:193:177; Interrogation_Position=2282; Antisense; AAACGGATTCCTCATGCCTAAAGTC
>probe:Drosophila_2:1637284_at:372:609; Interrogation_Position=2328; Antisense; TGAGCTAGTTTCAGACTTGACCCAC
>probe:Drosophila_2:1637284_at:525:103; Interrogation_Position=2340; Antisense; AGACTTGACCCACCGAAATATATGT
>probe:Drosophila_2:1637284_at:81:499; Interrogation_Position=2398; Antisense; GTCTACTTGCGATCAAATGCTTTGT
>probe:Drosophila_2:1637284_at:542:573; Interrogation_Position=2446; Antisense; GGCGCAAAGCCCCAAAGAAATCTTG
>probe:Drosophila_2:1637284_at:571:705; Interrogation_Position=2471; Antisense; TTAGACAACTTTACTGCTTTCAACA

Paste this into a BLAST search page for me
GAACGACGGGCCTGTATTGCTCTACTCTACAAGTTGAGCTGCGGCTCCAGGCGGCTCCAGCAGTTTTAATGTATTGATATAACTAAGTTCCTATTCCGGATATTCCGGAAACTTAATGGTCACATATTTATCTGCAAACGTAGTCACTGTAAACAGTGTCCTTTGTGAATTGCAAGAGAATTTTCAGTTCAGCTTTTAAGAAACGGATTCCTCATGCCTAAAGTCTGAGCTAGTTTCAGACTTGACCCACAGACTTGACCCACCGAAATATATGTGTCTACTTGCGATCAAATGCTTTGTGGCGCAAAGCCCCAAAGAAATCTTGTTAGACAACTTTACTGCTTTCAACA

Full Affymetrix probeset data:

Annotations for 1637284_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime