Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637285_s_at:

>probe:Drosophila_2:1637285_s_at:501:153; Interrogation_Position=1024; Antisense; ACATGTGGGACAGCAACACCTTCCT
>probe:Drosophila_2:1637285_s_at:181:719; Interrogation_Position=1044; Antisense; TTCCTCTATTCTCAAGCCATTCAAT
>probe:Drosophila_2:1637285_s_at:42:687; Interrogation_Position=1079; Antisense; TATAATTATTACTCCCCTTCGAACG
>probe:Drosophila_2:1637285_s_at:61:143; Interrogation_Position=1155; Antisense; ACTGGAAGGAACTCGCGCTAATGCT
>probe:Drosophila_2:1637285_s_at:338:61; Interrogation_Position=1231; Antisense; ATGTAAGCTTTGTAAGCCGCCGCAG
>probe:Drosophila_2:1637285_s_at:676:491; Interrogation_Position=1242; Antisense; GTAAGCCGCCGCAGATTTCGAAGAA
>probe:Drosophila_2:1637285_s_at:11:255; Interrogation_Position=748; Antisense; CAACACGGAGGTCAAGGGCATCGCT
>probe:Drosophila_2:1637285_s_at:517:409; Interrogation_Position=782; Antisense; GACGAACTTCTGCACAACACACGGC
>probe:Drosophila_2:1637285_s_at:702:157; Interrogation_Position=800; Antisense; ACACGGCGCTCCATCGACGAGGTGA
>probe:Drosophila_2:1637285_s_at:186:97; Interrogation_Position=852; Antisense; AGATCAGTGCGCAGGCCGCCAAGGC
>probe:Drosophila_2:1637285_s_at:322:251; Interrogation_Position=871; Antisense; CAAGGCGGCGAAGGCGATGCACATT
>probe:Drosophila_2:1637285_s_at:619:445; Interrogation_Position=886; Antisense; GATGCACATTACGTAGGTGTCGACA
>probe:Drosophila_2:1637285_s_at:165:363; Interrogation_Position=950; Antisense; GAATTATTTAGATGGCGCGCGGTCG
>probe:Drosophila_2:1637285_s_at:149:307; Interrogation_Position=966; Antisense; GCGCGGTCGTCGTTTTAGTACAACT

Paste this into a BLAST search page for me
ACATGTGGGACAGCAACACCTTCCTTTCCTCTATTCTCAAGCCATTCAATTATAATTATTACTCCCCTTCGAACGACTGGAAGGAACTCGCGCTAATGCTATGTAAGCTTTGTAAGCCGCCGCAGGTAAGCCGCCGCAGATTTCGAAGAACAACACGGAGGTCAAGGGCATCGCTGACGAACTTCTGCACAACACACGGCACACGGCGCTCCATCGACGAGGTGAAGATCAGTGCGCAGGCCGCCAAGGCCAAGGCGGCGAAGGCGATGCACATTGATGCACATTACGTAGGTGTCGACAGAATTATTTAGATGGCGCGCGGTCGGCGCGGTCGTCGTTTTAGTACAACT

Full Affymetrix probeset data:

Annotations for 1637285_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime