FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637287_at:

>probe:Drosophila_2:1637287_at:660:189; Interrogation_Position=1341; Antisense; AACATCTTTGACTGGCGCCGCTTGG
>probe:Drosophila_2:1637287_at:45:579; Interrogation_Position=1364; Antisense; GGCCACTTGTGGAGGCGCCAATTTA
>probe:Drosophila_2:1637287_at:176:71; Interrogation_Position=1376; Antisense; AGGCGCCAATTTACATCGACATCAA
>probe:Drosophila_2:1637287_at:67:583; Interrogation_Position=1401; Antisense; TGGCGAATATCGCAGCTATTGCCCG
>probe:Drosophila_2:1637287_at:308:521; Interrogation_Position=1444; Antisense; GTGGCAGTCCCAAATGGCGCCATCG
>probe:Drosophila_2:1637287_at:219:347; Interrogation_Position=1611; Antisense; GCATCAGCAACATTTGACGCCATCG
>probe:Drosophila_2:1637287_at:464:395; Interrogation_Position=1655; Antisense; GAAATATAGCACAGGCAGCAGCAGC
>probe:Drosophila_2:1637287_at:384:117; Interrogation_Position=1683; Antisense; AGCTTCAGCGCCTAGATTGCTGCTG
>probe:Drosophila_2:1637287_at:290:359; Interrogation_Position=1785; Antisense; GCAACAAATCGTGGCCGCTGGCAAG
>probe:Drosophila_2:1637287_at:83:299; Interrogation_Position=1800; Antisense; CGCTGGCAAGCGTAGCAAAGTTTAT
>probe:Drosophila_2:1637287_at:100:535; Interrogation_Position=1828; Antisense; GGTGAGTGGCCGTTTTATGACATTT
>probe:Drosophila_2:1637287_at:322:91; Interrogation_Position=1860; Antisense; AGTTTTTATTCCTGTCCATGATGCC
>probe:Drosophila_2:1637287_at:668:241; Interrogation_Position=1890; Antisense; CTATTTGGGTCCATATAGTTTGCCC
>probe:Drosophila_2:1637287_at:12:481; Interrogation_Position=1907; Antisense; GTTTGCCCAAAGAATGGCCCATGCA

Paste this into a BLAST search page for me
AACATCTTTGACTGGCGCCGCTTGGGGCCACTTGTGGAGGCGCCAATTTAAGGCGCCAATTTACATCGACATCAATGGCGAATATCGCAGCTATTGCCCGGTGGCAGTCCCAAATGGCGCCATCGGCATCAGCAACATTTGACGCCATCGGAAATATAGCACAGGCAGCAGCAGCAGCTTCAGCGCCTAGATTGCTGCTGGCAACAAATCGTGGCCGCTGGCAAGCGCTGGCAAGCGTAGCAAAGTTTATGGTGAGTGGCCGTTTTATGACATTTAGTTTTTATTCCTGTCCATGATGCCCTATTTGGGTCCATATAGTTTGCCCGTTTGCCCAAAGAATGGCCCATGCA

Full Affymetrix probeset data:

Annotations for 1637287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720