Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637288_at:

>probe:Drosophila_2:1637288_at:610:581; Interrogation_Position=128; Antisense; TGGCCCACACCCAACAGAATGTAGT
>probe:Drosophila_2:1637288_at:455:493; Interrogation_Position=151; Antisense; GTAAGGAGCTTCGATGGCACCGTCT
>probe:Drosophila_2:1637288_at:478:349; Interrogation_Position=222; Antisense; GCAGGACACGCGGATCAGCAACAAT
>probe:Drosophila_2:1637288_at:585:183; Interrogation_Position=241; Antisense; AACAATGTCTACCAGCCGGCGGTGG
>probe:Drosophila_2:1637288_at:340:103; Interrogation_Position=269; Antisense; AGACCTTCAGTTATGCTACAGCTCC
>probe:Drosophila_2:1637288_at:200:355; Interrogation_Position=309; Antisense; GCACCAGGCTCATCAGGAACCAAAA
>probe:Drosophila_2:1637288_at:339:165; Interrogation_Position=333; Antisense; AAATCTGTTTACTCAGGCATCGCCA
>probe:Drosophila_2:1637288_at:353:569; Interrogation_Position=348; Antisense; GGCATCGCCAGTTTACCAGCAGGAT
>probe:Drosophila_2:1637288_at:362:115; Interrogation_Position=365; Antisense; AGCAGGATGCTCATGTCCAGACTCC
>probe:Drosophila_2:1637288_at:16:203; Interrogation_Position=467; Antisense; AACCTGGTCATGTGGAGGCACCTTC
>probe:Drosophila_2:1637288_at:552:547; Interrogation_Position=480; Antisense; GGAGGCACCTTCTGTTTACCAACAG
>probe:Drosophila_2:1637288_at:345:407; Interrogation_Position=577; Antisense; GATGGTTTCGGTACCCACTACGGAT
>probe:Drosophila_2:1637288_at:90:595; Interrogation_Position=73; Antisense; TGGGCAGGTCTGATTGCTCAGCCGA
>probe:Drosophila_2:1637288_at:665:413; Interrogation_Position=96; Antisense; GACCATCACCTATGCTGGCAATGAG

Paste this into a BLAST search page for me
TGGCCCACACCCAACAGAATGTAGTGTAAGGAGCTTCGATGGCACCGTCTGCAGGACACGCGGATCAGCAACAATAACAATGTCTACCAGCCGGCGGTGGAGACCTTCAGTTATGCTACAGCTCCGCACCAGGCTCATCAGGAACCAAAAAAATCTGTTTACTCAGGCATCGCCAGGCATCGCCAGTTTACCAGCAGGATAGCAGGATGCTCATGTCCAGACTCCAACCTGGTCATGTGGAGGCACCTTCGGAGGCACCTTCTGTTTACCAACAGGATGGTTTCGGTACCCACTACGGATTGGGCAGGTCTGATTGCTCAGCCGAGACCATCACCTATGCTGGCAATGAG

Full Affymetrix probeset data:

Annotations for 1637288_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime