FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637290_at:

>probe:Drosophila_2:1637290_at:726:601; Interrogation_Position=196; Antisense; TGTTCACCAGTCTGCCAAGGGCACA
>probe:Drosophila_2:1637290_at:387:593; Interrogation_Position=229; Antisense; TGGGACCTAGAAGCTGTACGCACTT
>probe:Drosophila_2:1637290_at:651:333; Interrogation_Position=260; Antisense; GCTGTTTATGCCACTCTGGGCATTA
>probe:Drosophila_2:1637290_at:57:15; Interrogation_Position=281; Antisense; ATTAGCCTTCTGCTTCCTGGTGGTG
>probe:Drosophila_2:1637290_at:146:409; Interrogation_Position=323; Antisense; GACGACTAGTCTACAGAACGCTAAG
>probe:Drosophila_2:1637290_at:281:453; Interrogation_Position=396; Antisense; GATCAGCCCATTGCGAATTTAGTTG
>probe:Drosophila_2:1637290_at:284:95; Interrogation_Position=416; Antisense; AGTTGGACCATCATTCTCTCTATTC
>probe:Drosophila_2:1637290_at:717:55; Interrogation_Position=465; Antisense; ATGAGCTTCGGTCGCAGAGTGCCAC
>probe:Drosophila_2:1637290_at:716:99; Interrogation_Position=480; Antisense; AGAGTGCCACTAATTTCACGCCCAA
>probe:Drosophila_2:1637290_at:540:247; Interrogation_Position=512; Antisense; AATTGAGCTGGATCTCCTCATGGAT
>probe:Drosophila_2:1637290_at:145:205; Interrogation_Position=561; Antisense; AAGCGGTTTGATGATTACGGCCATA
>probe:Drosophila_2:1637290_at:482:57; Interrogation_Position=610; Antisense; ATGATCAGTTCGATGACTACGGTCA
>probe:Drosophila_2:1637290_at:573:537; Interrogation_Position=630; Antisense; GGTCACATGCGTTTCGGCCGATAAA
>probe:Drosophila_2:1637290_at:312:577; Interrogation_Position=645; Antisense; GGCCGATAAACACTTGCCATCAGTT

Paste this into a BLAST search page for me
TGTTCACCAGTCTGCCAAGGGCACATGGGACCTAGAAGCTGTACGCACTTGCTGTTTATGCCACTCTGGGCATTAATTAGCCTTCTGCTTCCTGGTGGTGGACGACTAGTCTACAGAACGCTAAGGATCAGCCCATTGCGAATTTAGTTGAGTTGGACCATCATTCTCTCTATTCATGAGCTTCGGTCGCAGAGTGCCACAGAGTGCCACTAATTTCACGCCCAAAATTGAGCTGGATCTCCTCATGGATAAGCGGTTTGATGATTACGGCCATAATGATCAGTTCGATGACTACGGTCAGGTCACATGCGTTTCGGCCGATAAAGGCCGATAAACACTTGCCATCAGTT

Full Affymetrix probeset data:

Annotations for 1637290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720