Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637291_at:

>probe:Drosophila_2:1637291_at:627:171; Interrogation_Position=1047; Antisense; AAAGAACCTGATGATCCCGGGCTGC
>probe:Drosophila_2:1637291_at:598:265; Interrogation_Position=1099; Antisense; CAGTTTCTCGTCTTTACCAAGCAGA
>probe:Drosophila_2:1637291_at:627:687; Interrogation_Position=1137; Antisense; TATTCTCGACTTGCTTCTAAGGATT
>probe:Drosophila_2:1637291_at:254:87; Interrogation_Position=1186; Antisense; AGTGCGGTTCGCAAGGCCTACCAAA
>probe:Drosophila_2:1637291_at:560:605; Interrogation_Position=1220; Antisense; TGATGCAGCCCTTCATGTTCAACAA
>probe:Drosophila_2:1637291_at:283:435; Interrogation_Position=1294; Antisense; GAGGGTTCTGCATTCAACTTCGATG
>probe:Drosophila_2:1637291_at:260:401; Interrogation_Position=1333; Antisense; GACATCCATGGCCTGGTGATCCAAT
>probe:Drosophila_2:1637291_at:32:533; Interrogation_Position=1347; Antisense; GGTGATCCAATCCTGCAGCAACATG
>probe:Drosophila_2:1637291_at:683:111; Interrogation_Position=1363; Antisense; AGCAACATGCTCCACAGTATCCGAA
>probe:Drosophila_2:1637291_at:166:485; Interrogation_Position=1379; Antisense; GTATCCGAACGCACTTGCTTCGAGA
>probe:Drosophila_2:1637291_at:49:225; Interrogation_Position=1440; Antisense; AAGGATCAAGGTGTTCCTCTACCGG
>probe:Drosophila_2:1637291_at:176:719; Interrogation_Position=1469; Antisense; TTCGCCTCTTTTTGCTTTACAAGCT
>probe:Drosophila_2:1637291_at:540:691; Interrogation_Position=1505; Antisense; TTTGGAGAAGCTATCTGGCGCATCT
>probe:Drosophila_2:1637291_at:137:583; Interrogation_Position=1520; Antisense; TGGCGCATCTCTTCTAGACTACAAT

Paste this into a BLAST search page for me
AAAGAACCTGATGATCCCGGGCTGCCAGTTTCTCGTCTTTACCAAGCAGATATTCTCGACTTGCTTCTAAGGATTAGTGCGGTTCGCAAGGCCTACCAAATGATGCAGCCCTTCATGTTCAACAAGAGGGTTCTGCATTCAACTTCGATGGACATCCATGGCCTGGTGATCCAATGGTGATCCAATCCTGCAGCAACATGAGCAACATGCTCCACAGTATCCGAAGTATCCGAACGCACTTGCTTCGAGAAAGGATCAAGGTGTTCCTCTACCGGTTCGCCTCTTTTTGCTTTACAAGCTTTTGGAGAAGCTATCTGGCGCATCTTGGCGCATCTCTTCTAGACTACAAT

Full Affymetrix probeset data:

Annotations for 1637291_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime