FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637292_at:

>probe:Drosophila_2:1637292_at:604:417; Interrogation_Position=1833; Antisense; GAGCTACTGACCACACAGTCGGGTG
>probe:Drosophila_2:1637292_at:466:603; Interrogation_Position=1870; Antisense; TGATCACGCCAGATCGATGCCTGAT
>probe:Drosophila_2:1637292_at:552:605; Interrogation_Position=1891; Antisense; TGATCTTCCCGTCTGTGGATTATGT
>probe:Drosophila_2:1637292_at:98:15; Interrogation_Position=1941; Antisense; ATTAGGCAAAATGTCCCAGTGGTCA
>probe:Drosophila_2:1637292_at:563:299; Interrogation_Position=1955; Antisense; CCCAGTGGTCATAGATGCGTCGCAT
>probe:Drosophila_2:1637292_at:90:333; Interrogation_Position=1989; Antisense; GCTGACTTCACAACGGCCACGGTTA
>probe:Drosophila_2:1637292_at:29:309; Interrogation_Position=2004; Antisense; GCCACGGTTATAGACTCGCTGATCA
>probe:Drosophila_2:1637292_at:48:439; Interrogation_Position=2044; Antisense; GAGGACAACTGCTCTTCTTCTACAA
>probe:Drosophila_2:1637292_at:52:173; Interrogation_Position=2073; Antisense; AAACCGAGTATCTGCTCCATTTTCG
>probe:Drosophila_2:1637292_at:678:629; Interrogation_Position=2088; Antisense; TCCATTTTCGAGCACGTGTCGGCGG
>probe:Drosophila_2:1637292_at:94:93; Interrogation_Position=2116; Antisense; AGTTCGTGGTCTACTACCAGGAGCA
>probe:Drosophila_2:1637292_at:94:193; Interrogation_Position=2169; Antisense; AACTATGTGCAGAAGCGGCTCGAGA
>probe:Drosophila_2:1637292_at:26:425; Interrogation_Position=2190; Antisense; GAGACGGCCTAACTGGCTTATTCTC
>probe:Drosophila_2:1637292_at:174:571; Interrogation_Position=2204; Antisense; GGCTTATTCTCCTCAACACGTGATA

Paste this into a BLAST search page for me
GAGCTACTGACCACACAGTCGGGTGTGATCACGCCAGATCGATGCCTGATTGATCTTCCCGTCTGTGGATTATGTATTAGGCAAAATGTCCCAGTGGTCACCCAGTGGTCATAGATGCGTCGCATGCTGACTTCACAACGGCCACGGTTAGCCACGGTTATAGACTCGCTGATCAGAGGACAACTGCTCTTCTTCTACAAAAACCGAGTATCTGCTCCATTTTCGTCCATTTTCGAGCACGTGTCGGCGGAGTTCGTGGTCTACTACCAGGAGCAAACTATGTGCAGAAGCGGCTCGAGAGAGACGGCCTAACTGGCTTATTCTCGGCTTATTCTCCTCAACACGTGATA

Full Affymetrix probeset data:

Annotations for 1637292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720