FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637293_at:

>probe:Drosophila_2:1637293_at:352:703; Interrogation_Position=2193; Antisense; TTATGTGATGGCTGCTCTGCTTTTA
>probe:Drosophila_2:1637293_at:436:177; Interrogation_Position=2229; Antisense; AAACTCGTGGAGCATTTCTGGTATA
>probe:Drosophila_2:1637293_at:679:643; Interrogation_Position=2287; Antisense; TCTCTGCCCTTCGAATCTTTTGATT
>probe:Drosophila_2:1637293_at:292:229; Interrogation_Position=2358; Antisense; AATGTGCACCGGATACGTTTTGTAT
>probe:Drosophila_2:1637293_at:35:33; Interrogation_Position=2381; Antisense; ATAAGCCTTTTCGTACTTCTGATCG
>probe:Drosophila_2:1637293_at:584:371; Interrogation_Position=2423; Antisense; GAAGGACATTTAGGCACCACCAGCA
>probe:Drosophila_2:1637293_at:581:679; Interrogation_Position=2493; Antisense; TAGTGTGGATCGTCTTATCCTGCTG
>probe:Drosophila_2:1637293_at:142:525; Interrogation_Position=2522; Antisense; GGGCTTGTGCCAACCGTAAATGCAA
>probe:Drosophila_2:1637293_at:299:29; Interrogation_Position=2546; Antisense; ATACTGTCGTATCGCGTTATGTGGC
>probe:Drosophila_2:1637293_at:20:259; Interrogation_Position=2584; Antisense; CACATACTGTGCCTATCTGATCCAT
>probe:Drosophila_2:1637293_at:144:273; Interrogation_Position=2614; Antisense; CATAATGTTCATTTGCTCTTCGCAC
>probe:Drosophila_2:1637293_at:303:153; Interrogation_Position=2637; Antisense; ACATGAGCGGCACTGTTCACCTAAG
>probe:Drosophila_2:1637293_at:314:283; Interrogation_Position=2675; Antisense; CTGACCTTGTTTTTAGGCAACGCCG
>probe:Drosophila_2:1637293_at:38:439; Interrogation_Position=2741; Antisense; GAGGCACCCGTTATCCGAATACTTA

Paste this into a BLAST search page for me
TTATGTGATGGCTGCTCTGCTTTTAAAACTCGTGGAGCATTTCTGGTATATCTCTGCCCTTCGAATCTTTTGATTAATGTGCACCGGATACGTTTTGTATATAAGCCTTTTCGTACTTCTGATCGGAAGGACATTTAGGCACCACCAGCATAGTGTGGATCGTCTTATCCTGCTGGGGCTTGTGCCAACCGTAAATGCAAATACTGTCGTATCGCGTTATGTGGCCACATACTGTGCCTATCTGATCCATCATAATGTTCATTTGCTCTTCGCACACATGAGCGGCACTGTTCACCTAAGCTGACCTTGTTTTTAGGCAACGCCGGAGGCACCCGTTATCCGAATACTTA

Full Affymetrix probeset data:

Annotations for 1637293_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720